Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   QNH41_RS02175 Genome accession   NZ_CP126100
Coordinates   430696..430818 (+) Length   40 a.a.
NCBI ID   WP_024120213.1    Uniprot ID   A0A9Q6A750
Organism   Bacillus halotolerans strain LN2     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 425696..435818
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QNH41_RS02160 (QNH41_02160) - 427301..427984 (+) 684 WP_106021120.1 response regulator transcription factor -
  QNH41_RS02165 (QNH41_02165) - 427971..429395 (+) 1425 WP_101860980.1 HAMP domain-containing sensor histidine kinase -
  QNH41_RS02170 (QNH41_02170) rapC 429564..430712 (+) 1149 WP_024120212.1 response regulator aspartate phosphatase RapC Regulator
  QNH41_RS02175 (QNH41_02175) phrC 430696..430818 (+) 123 WP_024120213.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  QNH41_RS02180 (QNH41_02180) - 430923..431015 (-) 93 WP_024120214.1 YjcZ family sporulation protein -
  QNH41_RS02185 (QNH41_02185) - 431162..431272 (-) 111 WP_106021023.1 YjcZ family sporulation protein -
  QNH41_RS02190 (QNH41_02190) - 431425..432789 (-) 1365 WP_095714086.1 aspartate kinase -
  QNH41_RS02195 (QNH41_02195) ceuB 433175..434125 (+) 951 WP_010333025.1 petrobactin ABC transporter permease YclN Machinery gene
  QNH41_RS02200 (QNH41_02200) yclO 434118..435065 (+) 948 WP_283912788.1 petrobactin ABC transporter permease YclO -
  QNH41_RS02205 (QNH41_02205) yclP 435059..435817 (+) 759 WP_283912789.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4267.00 Da        Isoelectric Point: 7.1634

>NTDB_id=835861 QNH41_RS02175 WP_024120213.1 430696..430818(+) (phrC) [Bacillus halotolerans strain LN2]
MKLKSKLFVICLAAAAVFTAVGVSEHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=835861 QNH41_RS02175 WP_024120213.1 430696..430818(+) (phrC) [Bacillus halotolerans strain LN2]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGAACATGC
TGAAGCATCCGACTTTCATGTCACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

87.5

100

0.875