Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   QNK08_RS02155 Genome accession   NZ_CP125983
Coordinates   427983..428105 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain ZKY04     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 422983..433105
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QNK08_RS02140 (QNK08_02155) yclJ 424597..425280 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  QNK08_RS02145 (QNK08_02160) yclK 425267..426688 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  QNK08_RS02150 (QNK08_02165) rapC 426851..427999 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  QNK08_RS02155 (QNK08_02170) phrC 427983..428105 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  QNK08_RS02160 (QNK08_02175) yczM 428204..428293 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  QNK08_RS02165 (QNK08_02180) yczN 428375..428488 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  QNK08_RS02170 (QNK08_02185) thrD 428641..430005 (-) 1365 WP_264379419.1 aspartate kinase -
  QNK08_RS02175 (QNK08_02190) ceuB 430390..431340 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  QNK08_RS02180 (QNK08_02195) yclO 431333..432280 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  QNK08_RS02185 (QNK08_02200) yclP 432274..433032 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=834035 QNK08_RS02155 WP_003224994.1 427983..428105(+) (phrC) [Bacillus subtilis strain ZKY04]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=834035 QNK08_RS02155 WP_003224994.1 427983..428105(+) (phrC) [Bacillus subtilis strain ZKY04]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1