Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   QL281_RS14695 Genome accession   NZ_CP125292
Coordinates   2739917..2740039 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM117797     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2734917..2745039
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QL281_RS14680 (QL281_14680) yclJ 2736530..2737213 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  QL281_RS14685 (QL281_14685) yclK 2737200..2738621 (+) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  QL281_RS14690 (QL281_14690) rapC 2738785..2739933 (+) 1149 WP_017696151.1 response regulator aspartate phosphatase RapC Regulator
  QL281_RS14695 (QL281_14695) phrC 2739917..2740039 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  QL281_RS14700 (QL281_14700) yczM 2740139..2740228 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  QL281_RS14705 (QL281_14705) yczN 2740310..2740423 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  QL281_RS14710 (QL281_14710) thrD 2740577..2741941 (-) 1365 WP_033883679.1 aspartate kinase -
  QL281_RS14715 (QL281_14715) ceuB 2742326..2743276 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  QL281_RS14720 (QL281_14720) yclO 2743269..2744216 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  QL281_RS14725 (QL281_14725) yclP 2744210..2744968 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=830920 QL281_RS14695 WP_003224994.1 2739917..2740039(+) (phrC) [Bacillus subtilis strain SRCM117797]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=830920 QL281_RS14695 WP_003224994.1 2739917..2740039(+) (phrC) [Bacillus subtilis strain SRCM117797]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1