Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   QHF92_RS02150 Genome accession   NZ_CP123994
Coordinates   424128..424250 (+) Length   40 a.a.
NCBI ID   WP_003240188.1    Uniprot ID   A0A9Q4EQJ2
Organism   Bacillus inaquosorum strain M3     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 419128..429250
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QHF92_RS02135 (QHF92_02135) yclJ 420747..421430 (+) 684 WP_003240180.1 two-component system response regulator YclJ -
  QHF92_RS02140 (QHF92_02140) - 421417..422838 (+) 1422 WP_080428959.1 HAMP domain-containing sensor histidine kinase -
  QHF92_RS02145 (QHF92_02145) rapC 422996..424144 (+) 1149 WP_019257465.1 response regulator aspartate phosphatase RapC Regulator
  QHF92_RS02150 (QHF92_02150) phrC 424128..424250 (+) 123 WP_003240188.1 phosphatase RapC inhibitor PhrC Regulator
  QHF92_RS02155 (QHF92_02155) - 424346..424453 (-) 108 WP_019257466.1 YjcZ family sporulation protein -
  QHF92_RS02160 (QHF92_02160) - 424604..425968 (-) 1365 WP_060397922.1 aspartate kinase -
  QHF92_RS02165 (QHF92_02165) ceuB 426353..427303 (+) 951 WP_003240192.1 petrobactin ABC transporter permease YclN Machinery gene
  QHF92_RS02170 (QHF92_02170) yclO 427296..428243 (+) 948 WP_060397923.1 petrobactin ABC transporter permease YclO -
  QHF92_RS02175 (QHF92_02175) yclP 428237..428995 (+) 759 WP_003240196.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4242.04 Da        Isoelectric Point: 8.0285

>NTDB_id=823696 QHF92_RS02150 WP_003240188.1 424128..424250(+) (phrC) [Bacillus inaquosorum strain M3]
MKLKSKLFVICLAAAAIFTVAGVSANAESLDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=823696 QHF92_RS02150 WP_003240188.1 424128..424250(+) (phrC) [Bacillus inaquosorum strain M3]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGTGGCTGGCGTTTCTGCTAACGC
CGAATCACTCGACTTTCATGTAACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

95

100

0.95