Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   QEP20_RS02165 Genome accession   NZ_CP123977
Coordinates   428206..428328 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain WH60A     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 423206..433328
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QEP20_RS02150 (QEP20_02150) yclJ 424820..425503 (+) 684 WP_128480739.1 two-component system response regulator YclJ -
  QEP20_RS02155 (QEP20_02155) yclK 425490..426911 (+) 1422 WP_080477807.1 two-component system sensor histidine kinase YclK -
  QEP20_RS02160 (QEP20_02160) rapC 427074..428222 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  QEP20_RS02165 (QEP20_02165) phrC 428206..428328 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  QEP20_RS02170 (QEP20_02170) yczM 428428..428517 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  QEP20_RS02175 (QEP20_02175) yczN 428599..428712 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  QEP20_RS02180 (QEP20_02180) thrD 428865..430229 (-) 1365 WP_029726569.1 aspartate kinase -
  QEP20_RS02185 (QEP20_02185) ceuB 430614..431564 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  QEP20_RS02190 (QEP20_02190) yclO 431557..432504 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  QEP20_RS02195 (QEP20_02195) yclP 432498..433256 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=823448 QEP20_RS02165 WP_003224994.1 428206..428328(+) (phrC) [Bacillus subtilis subsp. subtilis strain WH60A]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=823448 QEP20_RS02165 WP_003224994.1 428206..428328(+) (phrC) [Bacillus subtilis subsp. subtilis strain WH60A]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1