Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   LLNCDO1820_RS11210 Genome accession   NZ_CP120927
Coordinates   2186448..2186744 (-) Length   98 a.a.
NCBI ID   WP_010906316.1    Uniprot ID   A0A3N6L9Y1
Organism   Lactococcus lactis subsp. lactis strain NCDO1820     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2181448..2191744
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LLNCDO1820_RS11175 (LLNCDO1820_11170) - 2181738..2182604 (+) 867 WP_010906309.1 RluA family pseudouridine synthase -
  LLNCDO1820_RS11180 (LLNCDO1820_11175) - 2182643..2183452 (-) 810 WP_010906310.1 metal ABC transporter permease -
  LLNCDO1820_RS11185 (LLNCDO1820_11180) - 2183445..2184182 (-) 738 WP_010906311.1 metal ABC transporter ATP-binding protein -
  LLNCDO1820_RS11190 (LLNCDO1820_11185) - 2184359..2185201 (-) 843 WP_010906312.1 metal ABC transporter substrate-binding protein -
  LLNCDO1820_RS11195 (LLNCDO1820_11190) - 2185198..2185635 (-) 438 WP_010906313.1 zinc-dependent MarR family transcriptional regulator -
  LLNCDO1820_RS11200 (LLNCDO1820_11195) comGG 2185716..2186000 (-) 285 WP_010906314.1 competence type IV pilus minor pilin ComGG Machinery gene
  LLNCDO1820_RS11205 (LLNCDO1820_11200) comGF 2186039..2186485 (-) 447 WP_031296844.1 competence type IV pilus minor pilin ComGF Machinery gene
  LLNCDO1820_RS11210 (LLNCDO1820_11205) comGE 2186448..2186744 (-) 297 WP_010906316.1 competence type IV pilus minor pilin ComGE Machinery gene
  LLNCDO1820_RS11215 (LLNCDO1820_11210) comGD 2186716..2187114 (-) 399 WP_021214886.1 competence type IV pilus minor pilin ComGD Machinery gene
  LLNCDO1820_RS11220 (LLNCDO1820_11215) comGC 2187107..2187490 (-) 384 WP_010906318.1 competence type IV pilus major pilin ComGC Machinery gene
  LLNCDO1820_RS11225 (LLNCDO1820_11220) comGB 2187504..2188577 (-) 1074 WP_010906319.1 competence type IV pilus assembly protein ComGB Machinery gene
  LLNCDO1820_RS11230 (LLNCDO1820_11225) comGA 2188471..2189409 (-) 939 WP_010906320.1 competence type IV pilus ATPase ComGA Machinery gene

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 11076.95 Da        Isoelectric Point: 6.4684

>NTDB_id=809403 LLNCDO1820_RS11210 WP_010906316.1 2186448..2186744(-) (comGE) [Lactococcus lactis subsp. lactis strain NCDO1820]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=809403 LLNCDO1820_RS11210 WP_010906316.1 2186448..2186744(-) (comGE) [Lactococcus lactis subsp. lactis strain NCDO1820]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB A0A3N6L9Y1

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

68.041

98.98

0.673