Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   LLHP_RS11830 Genome accession   NZ_CP120921
Coordinates   2264014..2264250 (-) Length   78 a.a.
NCBI ID   WP_014573335.1    Uniprot ID   -
Organism   Lactococcus cremoris subsp. cremoris HP     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type MGE coordinates Gene coordinates Relative position Distance (bp)
ICE 2243806..2263202 2264014..2264250 flank 812


Gene organization within MGE regions


Location: 2243806..2264250
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LLHP_RS11715 (LLHP_11760) - 2243806..2244741 (+) 936 WP_031559015.1 IS30 family transposase -
  LLHP_RS11720 (LLHP_11765) - 2244918..2245807 (-) 890 Protein_2283 IS982 family transposase -
  LLHP_RS11725 (LLHP_11770) mscL 2245916..2246281 (+) 366 WP_032951281.1 large-conductance mechanosensitive channel protein MscL -
  LLHP_RS11730 (LLHP_11775) - 2246320..2247609 (-) 1290 WP_032951279.1 MATE family efflux transporter -
  LLHP_RS11735 (LLHP_11780) thrC 2247606..2249096 (-) 1491 WP_011677165.1 threonine synthase -
  LLHP_RS11740 (LLHP_11785) nusG 2249195..2249752 (-) 558 WP_011677166.1 transcription termination/antitermination protein NusG -
  LLHP_RS11745 (LLHP_11790) secE 2249959..2250153 (-) 195 WP_011677167.1 preprotein translocase subunit SecE -
  LLHP_RS11750 (LLHP_11795) rpmG 2250234..2250383 (-) 150 WP_011677168.1 50S ribosomal protein L33 -
  LLHP_RS11755 (LLHP_11800) - 2250424..2252241 (-) 1818 WP_063280762.1 acyltransferase family protein -
  LLHP_RS11760 (LLHP_11805) - 2252343..2254574 (-) 2232 WP_032951287.1 PBP1A family penicillin-binding protein -
  LLHP_RS11765 (LLHP_11810) - 2254961..2255596 (-) 636 WP_011677171.1 DUF421 domain-containing protein -
  LLHP_RS11770 (LLHP_11815) - 2255614..2255895 (-) 282 WP_257589792.1 DUF3290 domain-containing protein -
  LLHP_RS11775 (LLHP_11820) - 2255989..2256924 (+) 936 WP_031559015.1 IS30 family transposase -
  LLHP_RS11780 (LLHP_11825) - 2256950..2257120 (-) 171 Protein_2295 DUF3290 family protein -
  LLHP_RS11785 (LLHP_11830) - 2257235..2257612 (-) 378 Protein_2296 pyridoxamine 5'-phosphate oxidase family protein -
  LLHP_RS11790 (LLHP_11835) - 2257806..2258678 (+) 873 WP_032951293.1 RluA family pseudouridine synthase -
  LLHP_RS11800 (LLHP_11845) - 2260208..2261017 (-) 810 WP_011677177.1 metal ABC transporter permease -
  LLHP_RS11805 (LLHP_11850) - 2261010..2261747 (-) 738 WP_011677178.1 metal ABC transporter ATP-binding protein -
  LLHP_RS11810 (LLHP_11855) - 2261926..2262768 (-) 843 WP_011677179.1 metal ABC transporter solute-binding protein, Zn/Mn family -
  LLHP_RS11815 (LLHP_11860) - 2262765..2263202 (-) 438 WP_011677180.1 zinc-dependent MarR family transcriptional regulator -
  LLHP_RS11820 (LLHP_11865) comGG 2263282..2263509 (-) 228 WP_228764408.1 competence protein ComGG Machinery gene
  LLHP_RS11825 (LLHP_11870) comGF 2263605..2264051 (-) 447 WP_011836043.1 competence type IV pilus minor pilin ComGF Machinery gene
  LLHP_RS11830 (LLHP_11875) comGE 2264014..2264250 (-) 237 WP_014573335.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 78 a.a.        Molecular weight: 8700.94 Da        Isoelectric Point: 4.3885

>NTDB_id=809354 LLHP_RS11830 WP_014573335.1 2264014..2264250(-) (comGE) [Lactococcus cremoris subsp. cremoris HP]
MALLSFLVTFLLSALTNSRQQEVQENQQIESLNVAQMAIESQLMELSLNGSVIKIRQDSTATIISDHGKEILRLEAQN

Nucleotide


Download         Length: 237 bp        

>NTDB_id=809354 LLHP_RS11830 WP_014573335.1 2264014..2264250(-) (comGE) [Lactococcus cremoris subsp. cremoris HP]
ATGGCATTATTGAGCTTTTTGGTCACTTTTCTCTTAAGTGCTCTTACTAATTCTCGTCAGCAAGAGGTACAAGAAAATCA
ACAAATTGAGTCCTTAAATGTAGCTCAGATGGCAATAGAAAGTCAGCTGATGGAACTATCGTTAAATGGTTCTGTTATAA
AAATAAGACAAGATTCGACTGCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(1-74)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

96.154

100

0.962