Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   P5647_RS02020 Genome accession   NZ_CP120622
Coordinates   399771..399893 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain DSM 1090     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 394771..404893
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  P5647_RS02005 (P5647_02005) yclJ 396385..397068 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  P5647_RS02010 (P5647_02010) yclK 397055..398476 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  P5647_RS02015 (P5647_02015) rapC 398639..399787 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  P5647_RS02020 (P5647_02020) phrC 399771..399893 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  P5647_RS02025 (P5647_02025) yczM 399993..400082 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  P5647_RS02030 (P5647_02030) yczN 400164..400277 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  P5647_RS02035 (P5647_02035) thrD 400431..401795 (-) 1365 WP_003234493.1 aspartate kinase -
  P5647_RS02040 (P5647_02040) ceuB 402180..403130 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  P5647_RS02045 (P5647_02045) yclO 403123..404070 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  P5647_RS02050 (P5647_02050) yclP 404064..404822 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=807099 P5647_RS02020 WP_003224994.1 399771..399893(+) (phrC) [Bacillus subtilis strain DSM 1090]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=807099 P5647_RS02020 WP_003224994.1 399771..399893(+) (phrC) [Bacillus subtilis strain DSM 1090]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1