Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   P5657_RS01045 Genome accession   NZ_CP120621
Coordinates   185550..185672 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain DSM 13019     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 180550..190672
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  P5657_RS01015 (P5657_01015) yclP 180622..181380 (-) 759 WP_277710166.1 petrobactin ABC transporter ATP-binding protein YclP -
  P5657_RS01020 (P5657_01020) yclO 181374..182321 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  P5657_RS01025 (P5657_01025) ceuB 182314..183264 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  P5657_RS01030 (P5657_01030) thrD 183649..185013 (+) 1365 WP_021481755.1 aspartate kinase -
  P5657_RS01035 (P5657_01035) yczN 185166..185279 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  P5657_RS01040 (P5657_01040) yczM 185361..185450 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  P5657_RS01045 (P5657_01045) phrC 185550..185672 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  P5657_RS01050 (P5657_01050) rapC 185656..186804 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  P5657_RS01055 (P5657_01055) yclK 186967..188388 (-) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  P5657_RS01060 (P5657_01060) yclJ 188375..189058 (-) 684 WP_015482792.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=807014 P5657_RS01045 WP_003224994.1 185550..185672(-) (phrC) [Bacillus subtilis strain DSM 13019]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=807014 P5657_RS01045 WP_003224994.1 185550..185672(-) (phrC) [Bacillus subtilis strain DSM 13019]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1