Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   P5649_RS02715 Genome accession   NZ_CP120613
Coordinates   521462..521584 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain DSM 23521     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 516462..526584
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  P5649_RS02685 (P5649_02685) yclP 516533..517291 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  P5649_RS02690 (P5649_02690) yclO 517285..518232 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  P5649_RS02695 (P5649_02695) ceuB 518225..519175 (-) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  P5649_RS02700 (P5649_02700) thrD 519560..520924 (+) 1365 WP_009966541.1 aspartate kinase -
  P5649_RS02705 (P5649_02705) yczN 521078..521191 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  P5649_RS02710 (P5649_02710) yczM 521273..521362 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  P5649_RS02715 (P5649_02715) phrC 521462..521584 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  P5649_RS02720 (P5649_02720) rapC 521568..522716 (-) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  P5649_RS02725 (P5649_02725) yclK 522879..524300 (-) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  P5649_RS02730 (P5649_02730) yclJ 524287..524970 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=806876 P5649_RS02715 WP_003224994.1 521462..521584(-) (phrC) [Bacillus subtilis strain DSM 23521]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=806876 P5649_RS02715 WP_003224994.1 521462..521584(-) (phrC) [Bacillus subtilis strain DSM 23521]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1