Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   PT671_RS07680 Genome accession   NZ_CP118021
Coordinates   1567203..1567325 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus spizizenii strain B-354     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 1562203..1572325
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  PT671_RS07655 yclP 1562457..1563215 (-) 759 WP_003225005.1 petrobactin ABC transporter ATP-binding protein YclP -
  PT671_RS07660 yclO 1563209..1564156 (-) 948 WP_003225003.1 petrobactin ABC transporter permease YclO -
  PT671_RS07665 ceuB 1564149..1565099 (-) 951 WP_003225000.1 petrobactin ABC transporter permease YclN Machinery gene
  PT671_RS07670 - 1565484..1566848 (+) 1365 WP_003224998.1 aspartate kinase -
  PT671_RS07675 - 1566997..1567104 (+) 108 WP_003224996.1 YjcZ family sporulation protein -
  PT671_RS07680 phrC 1567203..1567325 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  PT671_RS07685 rapC 1567309..1568457 (-) 1149 WP_003224987.1 response regulator aspartate phosphatase RapC Regulator
  PT671_RS07690 yclK 1568619..1570040 (-) 1422 WP_079996289.1 two-component system sensor histidine kinase YclK -
  PT671_RS07695 yclJ 1570027..1570710 (-) 684 WP_003224983.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=789144 PT671_RS07680 WP_003224994.1 1567203..1567325(-) (phrC) [Bacillus spizizenii strain B-354]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=789144 PT671_RS07680 WP_003224994.1 1567203..1567325(-) (phrC) [Bacillus spizizenii strain B-354]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAACGC
GGAAGCACTCGACTTTCATGTGACGGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1