Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   PIB33_RS02175 Genome accession   NZ_CP116391
Coordinates   429492..429614 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain GXD-20     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 424492..434614
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  PIB33_RS02160 (PIB33_02160) yclJ 426106..426789 (+) 684 WP_032722955.1 two-component system response regulator YclJ -
  PIB33_RS02165 (PIB33_02165) yclK 426776..428197 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  PIB33_RS02170 (PIB33_02170) rapC 428360..429508 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  PIB33_RS02175 (PIB33_02175) phrC 429492..429614 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  PIB33_RS02180 (PIB33_02180) yczM 429714..429803 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  PIB33_RS02185 (PIB33_02185) yczN 429885..429998 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  PIB33_RS02190 (PIB33_02190) thrD 430151..431515 (-) 1365 WP_015715246.1 aspartate kinase -
  PIB33_RS02195 (PIB33_02195) ceuB 431900..432850 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  PIB33_RS02200 (PIB33_02200) yclO 432843..433790 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  PIB33_RS02205 (PIB33_02205) yclP 433784..434542 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=776991 PIB33_RS02175 WP_003224994.1 429492..429614(+) (phrC) [Bacillus subtilis strain GXD-20]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=776991 PIB33_RS02175 WP_003224994.1 429492..429614(+) (phrC) [Bacillus subtilis strain GXD-20]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1