Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   O0R52_RS12600 Genome accession   NZ_CP114066
Coordinates   2517131..2517304 (+) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus halotolerans strain B13     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2512131..2522304
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  O0R52_RS12585 (O0R52_12585) gcvT 2512928..2514016 (-) 1089 WP_217827775.1 glycine cleavage system aminomethyltransferase GcvT -
  O0R52_RS12590 (O0R52_12590) - 2514460..2516133 (+) 1674 WP_059293610.1 DEAD/DEAH box helicase -
  O0R52_RS12595 (O0R52_12595) - 2516153..2516947 (+) 795 WP_256766236.1 YqhG family protein -
  O0R52_RS12600 (O0R52_12600) sinI 2517131..2517304 (+) 174 WP_024122036.1 anti-repressor SinI Regulator
  O0R52_RS12605 (O0R52_12605) sinR 2517338..2517673 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  O0R52_RS12610 (O0R52_12610) tasA 2517759..2518544 (-) 786 WP_059293609.1 biofilm matrix protein TasA -
  O0R52_RS12615 (O0R52_12615) sipW 2518609..2519193 (-) 585 WP_059293608.1 signal peptidase I SipW -
  O0R52_RS12620 (O0R52_12620) tapA 2519165..2519926 (-) 762 WP_217827776.1 amyloid fiber anchoring/assembly protein TapA -
  O0R52_RS12625 (O0R52_12625) - 2520203..2520526 (+) 324 WP_024122040.1 YqzG/YhdC family protein -
  O0R52_RS12630 (O0R52_12630) - 2520569..2520748 (-) 180 WP_003236949.1 YqzE family protein -
  O0R52_RS12635 (O0R52_12635) comGG 2520820..2521194 (-) 375 WP_217827777.1 competence type IV pilus minor pilin ComGG Machinery gene
  O0R52_RS12640 (O0R52_12640) comGF 2521195..2521578 (-) 384 WP_217827778.1 competence type IV pilus minor pilin ComGF Machinery gene
  O0R52_RS12645 (O0R52_12645) comGE 2521604..2521951 (-) 348 WP_217827779.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=764388 O0R52_RS12600 WP_024122036.1 2517131..2517304(+) (sinI) [Bacillus halotolerans strain B13]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=764388 O0R52_RS12600 WP_024122036.1 2517131..2517304(+) (sinI) [Bacillus halotolerans strain B13]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947