Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   O0R52_RS02160 Genome accession   NZ_CP114066
Coordinates   426645..426767 (+) Length   40 a.a.
NCBI ID   WP_010333023.1    Uniprot ID   Q6B9X2
Organism   Bacillus halotolerans strain B13     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 421645..431767
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  O0R52_RS02145 (O0R52_02145) yclJ 423247..423930 (+) 684 WP_227534190.1 two-component system response regulator YclJ -
  O0R52_RS02150 (O0R52_02150) - 423917..425326 (+) 1410 WP_082687805.1 sensor histidine kinase -
  O0R52_RS02155 (O0R52_02155) rapC 425513..426661 (+) 1149 WP_044161883.1 response regulator aspartate phosphatase RapC Regulator
  O0R52_RS02160 (O0R52_02160) phrC 426645..426767 (+) 123 WP_010333023.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  O0R52_RS02165 (O0R52_02165) - 426872..426964 (-) 93 WP_024120214.1 YjcZ family sporulation protein -
  O0R52_RS02170 (O0R52_02170) - 427111..427221 (-) 111 WP_024120215.1 YjcZ family sporulation protein -
  O0R52_RS02175 (O0R52_02175) - 427374..428738 (-) 1365 WP_269107780.1 aspartate kinase -
  O0R52_RS02180 (O0R52_02180) ceuB 429124..430074 (+) 951 WP_099043690.1 petrobactin ABC transporter permease YclN Machinery gene
  O0R52_RS02185 (O0R52_02185) yclO 430067..431014 (+) 948 WP_227534189.1 petrobactin ABC transporter permease YclO -
  O0R52_RS02190 (O0R52_02190) yclP 431008..431766 (+) 759 WP_024120218.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4208.97 Da        Isoelectric Point: 8.0579

>NTDB_id=764357 O0R52_RS02160 WP_010333023.1 426645..426767(+) (phrC) [Bacillus halotolerans strain B13]
MKLKSKLFVICLAAAAVFTAVGVSAHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=764357 O0R52_RS02160 WP_010333023.1 426645..426767(+) (phrC) [Bacillus halotolerans strain B13]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGCACATGC
TGAAGCATCCGACTTTCATGTCACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB Q6B9X2

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

90

100

0.9