Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   LFL98_RS02135 Genome accession   NZ_CP110365
Coordinates   420455..420577 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain HY2-62     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 415455..425577
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LFL98_RS02120 (LFL98_02120) yclJ 417069..417752 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  LFL98_RS02125 (LFL98_02125) yclK 417739..419160 (+) 1422 WP_116316414.1 two-component system sensor histidine kinase YclK -
  LFL98_RS02130 (LFL98_02130) rapC 419323..420471 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  LFL98_RS02135 (LFL98_02135) phrC 420455..420577 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  LFL98_RS02140 (LFL98_02140) yczM 420677..420766 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  LFL98_RS02145 (LFL98_02145) yczN 420848..420961 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  LFL98_RS02150 (LFL98_02150) thrD 421115..422479 (-) 1365 WP_277736915.1 aspartate kinase -
  LFL98_RS02155 (LFL98_02155) ceuB 422864..423814 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  LFL98_RS02160 (LFL98_02160) yclO 423807..424754 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  LFL98_RS02165 (LFL98_02165) yclP 424748..425506 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=754593 LFL98_RS02135 WP_003224994.1 420455..420577(+) (phrC) [Bacillus subtilis strain HY2-62]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=754593 LFL98_RS02135 WP_003224994.1 420455..420577(+) (phrC) [Bacillus subtilis strain HY2-62]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1