Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   ODQ18_RS13495 Genome accession   NZ_CP107039
Coordinates   2590729..2590851 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain 11060     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 2585729..2595851
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ODQ18_RS13465 (ODQ18_13465) yclP 2585798..2586556 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  ODQ18_RS13470 (ODQ18_13470) yclO 2586550..2587497 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ODQ18_RS13475 (ODQ18_13475) ceuB 2587490..2588440 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ODQ18_RS13480 (ODQ18_13480) thrD 2588825..2590189 (+) 1365 WP_043940054.1 aspartate kinase -
  ODQ18_RS13485 (ODQ18_13485) yczN 2590343..2590456 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  ODQ18_RS13490 (ODQ18_13490) yczM 2590538..2590627 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  ODQ18_RS13495 (ODQ18_13495) phrC 2590729..2590851 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ODQ18_RS13500 (ODQ18_13500) rapC 2590835..2591983 (-) 1149 WP_043940053.1 response regulator aspartate phosphatase RapC Regulator
  ODQ18_RS13505 (ODQ18_13505) yclK 2592147..2593568 (-) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  ODQ18_RS13510 (ODQ18_13510) yclJ 2593555..2594238 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=737657 ODQ18_RS13495 WP_003224994.1 2590729..2590851(-) (phrC) [Bacillus subtilis strain 11060]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=737657 ODQ18_RS13495 WP_003224994.1 2590729..2590851(-) (phrC) [Bacillus subtilis strain 11060]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1