Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   N1207_RS02130 Genome accession   NZ_CP104097
Coordinates   421523..421645 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain GL-4     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 416523..426645
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  N1207_RS02115 (N1207_02115) yclJ 418136..418819 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  N1207_RS02120 (N1207_02120) yclK 418806..420227 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  N1207_RS02125 (N1207_02125) rapC 420391..421539 (+) 1149 WP_043940053.1 response regulator aspartate phosphatase RapC Regulator
  N1207_RS02130 (N1207_02130) phrC 421523..421645 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  N1207_RS02135 (N1207_02135) yczM 421747..421836 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  N1207_RS02140 (N1207_02140) yczN 421918..422031 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  N1207_RS02145 (N1207_02145) thrD 422185..423549 (-) 1365 WP_043940054.1 aspartate kinase -
  N1207_RS02150 (N1207_02150) ceuB 423934..424884 (+) 951 WP_260196893.1 petrobactin ABC transporter permease YclN Machinery gene
  N1207_RS02155 (N1207_02155) yclO 424877..425824 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  N1207_RS02160 (N1207_02160) yclP 425818..426576 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=727532 N1207_RS02130 WP_003224994.1 421523..421645(+) (phrC) [Bacillus subtilis strain GL-4]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=727532 N1207_RS02130 WP_003224994.1 421523..421645(+) (phrC) [Bacillus subtilis strain GL-4]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1