Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   N0B18_RS02155 Genome accession   NZ_CP103995
Coordinates   426020..426142 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM117109     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 421020..431142
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  N0B18_RS02140 (N0B18_02140) yclJ 422634..423317 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  N0B18_RS02145 (N0B18_02145) yclK 423304..424725 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  N0B18_RS02150 (N0B18_02150) rapC 424888..426036 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  N0B18_RS02155 (N0B18_02155) phrC 426020..426142 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  N0B18_RS02160 (N0B18_02160) yczM 426241..426330 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  N0B18_RS02165 (N0B18_02165) yczN 426412..426525 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  N0B18_RS02170 (N0B18_02170) thrD 426678..428042 (-) 1365 WP_021481755.1 aspartate kinase -
  N0B18_RS02175 (N0B18_02175) ceuB 428433..429383 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  N0B18_RS02180 (N0B18_02180) yclO 429376..430323 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  N0B18_RS02185 (N0B18_02185) yclP 430317..431075 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=726810 N0B18_RS02155 WP_003224994.1 426020..426142(+) (phrC) [Bacillus subtilis strain SRCM117109]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=726810 N0B18_RS02155 WP_003224994.1 426020..426142(+) (phrC) [Bacillus subtilis strain SRCM117109]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1