Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NYR91_RS02125 Genome accession   NZ_CP103784
Coordinates   420906..421028 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain RO-NN-1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 415906..426028
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NYR91_RS02110 (NYR91_02110) yclJ 417520..418203 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  NYR91_RS02115 (NYR91_02115) yclK 418190..419611 (+) 1422 WP_080009753.1 two-component system sensor histidine kinase YclK -
  NYR91_RS02120 (NYR91_02120) rapC 419774..420922 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  NYR91_RS02125 (NYR91_02125) phrC 420906..421028 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NYR91_RS02130 (NYR91_02130) yczM 421128..421217 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NYR91_RS02135 (NYR91_02135) yczN 421299..421412 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  NYR91_RS02140 (NYR91_02140) thrD 421565..422929 (-) 1365 WP_014475802.1 aspartate kinase -
  NYR91_RS02145 (NYR91_02145) ceuB 423314..424264 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NYR91_RS02150 (NYR91_02150) yclO 424257..425204 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  NYR91_RS02155 (NYR91_02155) yclP 425198..425956 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=724987 NYR91_RS02125 WP_003224994.1 420906..421028(+) (phrC) [Bacillus subtilis strain RO-NN-1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=724987 NYR91_RS02125 WP_003224994.1 420906..421028(+) (phrC) [Bacillus subtilis strain RO-NN-1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1