Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NX810_RS02170 Genome accession   NZ_CP103350
Coordinates   429850..429972 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM117108     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424850..434972
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NX810_RS02155 (NX810_02155) yclJ 426464..427147 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  NX810_RS02160 (NX810_02160) yclK 427134..428555 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  NX810_RS02165 (NX810_02165) rapC 428718..429866 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  NX810_RS02170 (NX810_02170) phrC 429850..429972 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NX810_RS02175 (NX810_02175) yczM 430072..430161 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NX810_RS02180 (NX810_02180) yczN 430243..430356 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  NX810_RS02185 (NX810_02185) thrD 430510..431874 (-) 1365 WP_003234493.1 aspartate kinase -
  NX810_RS02190 (NX810_02190) ceuB 432259..433209 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NX810_RS02195 (NX810_02195) yclO 433202..434149 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  NX810_RS02200 (NX810_02200) yclP 434143..434901 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=722107 NX810_RS02170 WP_003224994.1 429850..429972(+) (phrC) [Bacillus subtilis strain SRCM117108]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=722107 NX810_RS02170 WP_003224994.1 429850..429972(+) (phrC) [Bacillus subtilis strain SRCM117108]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1