Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NLV76_RS02220 Genome accession   NZ_CP100752
Coordinates   433040..433162 (+) Length   40 a.a.
NCBI ID   WP_010333023.1    Uniprot ID   Q6B9X2
Organism   Bacillus halotolerans strain MEC_B301     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 428040..438162
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NLV76_RS02205 (NLV76_02205) yclJ 429642..430325 (+) 684 WP_024120210.1 two-component system response regulator YclJ -
  NLV76_RS02210 (NLV76_02210) - 430312..431721 (+) 1410 WP_082687805.1 HAMP domain-containing sensor histidine kinase -
  NLV76_RS02215 (NLV76_02215) rapC 431908..433056 (+) 1149 WP_024120212.1 response regulator aspartate phosphatase RapC Regulator
  NLV76_RS02220 (NLV76_02220) phrC 433040..433162 (+) 123 WP_010333023.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  NLV76_RS02225 (NLV76_02225) - 433267..433359 (-) 93 WP_024120214.1 YjcZ family sporulation protein -
  NLV76_RS02230 (NLV76_02230) - 433506..433616 (-) 111 WP_024120215.1 YjcZ family sporulation protein -
  NLV76_RS02235 (NLV76_02235) - 433769..435133 (-) 1365 WP_254502437.1 aspartate kinase -
  NLV76_RS02240 (NLV76_02240) ceuB 435519..436469 (+) 951 WP_254502439.1 petrobactin ABC transporter permease YclN Machinery gene
  NLV76_RS02245 (NLV76_02245) yclO 436462..437409 (+) 948 WP_024120217.1 petrobactin ABC transporter permease YclO -
  NLV76_RS02250 (NLV76_02250) yclP 437403..438161 (+) 759 WP_254502441.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4208.97 Da        Isoelectric Point: 8.0579

>NTDB_id=706654 NLV76_RS02220 WP_010333023.1 433040..433162(+) (phrC) [Bacillus halotolerans strain MEC_B301]
MKLKSKLFVICLAAAAVFTAVGVSAHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=706654 NLV76_RS02220 WP_010333023.1 433040..433162(+) (phrC) [Bacillus halotolerans strain MEC_B301]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGCACATGC
TGAAGCATCCGACTTTCATGTCACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB Q6B9X2

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

90

100

0.9