Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   NLW79_RS13460 Genome accession   NZ_CP100651
Coordinates   2608410..2608583 (+) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus halotolerans strain MEC_B334     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2603410..2613583
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NLW79_RS13445 (NLW79_13445) gcvT 2604208..2605296 (-) 1089 WP_059293611.1 glycine cleavage system aminomethyltransferase GcvT -
  NLW79_RS13450 (NLW79_13450) - 2605739..2607412 (+) 1674 WP_254517744.1 DEAD/DEAH box helicase -
  NLW79_RS13455 (NLW79_13455) - 2607432..2608226 (+) 795 WP_127696773.1 YqhG family protein -
  NLW79_RS13460 (NLW79_13460) sinI 2608410..2608583 (+) 174 WP_024122036.1 anti-repressor SinI Regulator
  NLW79_RS13465 (NLW79_13465) sinR 2608617..2608952 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  NLW79_RS13470 (NLW79_13470) tasA 2609039..2609824 (-) 786 WP_106020091.1 biofilm matrix protein TasA -
  NLW79_RS13475 (NLW79_13475) sipW 2609889..2610473 (-) 585 WP_105955579.1 signal peptidase I SipW -
  NLW79_RS13480 (NLW79_13480) tapA 2610445..2611206 (-) 762 WP_106020093.1 amyloid fiber anchoring/assembly protein TapA -
  NLW79_RS13485 (NLW79_13485) - 2611484..2611807 (+) 324 WP_024122040.1 YqzG/YhdC family protein -
  NLW79_RS13490 (NLW79_13490) - 2611850..2612029 (-) 180 WP_003236949.1 YqzE family protein -
  NLW79_RS13495 (NLW79_13495) comGG 2612101..2612475 (-) 375 WP_106020094.1 competence type IV pilus minor pilin ComGG Machinery gene
  NLW79_RS13500 (NLW79_13500) comGF 2612476..2612859 (-) 384 WP_038954226.1 competence type IV pilus minor pilin ComGF Machinery gene
  NLW79_RS13505 (NLW79_13505) comGE 2612885..2613232 (-) 348 WP_254517746.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=706009 NLW79_RS13460 WP_024122036.1 2608410..2608583(+) (sinI) [Bacillus halotolerans strain MEC_B334]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=706009 NLW79_RS13460 WP_024122036.1 2608410..2608583(+) (sinI) [Bacillus halotolerans strain MEC_B334]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947