Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   NDR85_RS12590 Genome accession   NZ_CP098738
Coordinates   2519660..2519833 (+) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus halotolerans strain XE48     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2514660..2524833
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NDR85_RS12575 (NDR85_12550) gcvT 2515457..2516545 (-) 1089 WP_044154615.1 glycine cleavage system aminomethyltransferase GcvT -
  NDR85_RS12580 (NDR85_12555) - 2516989..2518662 (+) 1674 WP_044154608.1 DEAD/DEAH box helicase -
  NDR85_RS12585 (NDR85_12560) - 2518682..2519476 (+) 795 WP_044154602.1 YqhG family protein -
  NDR85_RS12590 (NDR85_12565) sinI 2519660..2519833 (+) 174 WP_024122036.1 anti-repressor SinI Regulator
  NDR85_RS12595 (NDR85_12570) sinR 2519867..2520202 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  NDR85_RS12600 (NDR85_12575) tasA 2520288..2521073 (-) 786 WP_044154586.1 biofilm matrix protein TasA -
  NDR85_RS12605 (NDR85_12580) sipW 2521138..2521722 (-) 585 WP_044154585.1 signal peptidase I SipW -
  NDR85_RS12610 (NDR85_12585) tapA 2521694..2522455 (-) 762 WP_044154584.1 amyloid fiber anchoring/assembly protein TapA -
  NDR85_RS12615 (NDR85_12590) - 2522732..2523055 (+) 324 WP_024122040.1 YqzG/YhdC family protein -
  NDR85_RS12620 (NDR85_12595) - 2523098..2523277 (-) 180 WP_003236949.1 YqzE family protein -
  NDR85_RS12625 (NDR85_12600) comGG 2523349..2523723 (-) 375 WP_044154582.1 competence type IV pilus minor pilin ComGG Machinery gene
  NDR85_RS12630 (NDR85_12605) comGF 2523724..2524107 (-) 384 WP_227533974.1 competence type IV pilus minor pilin ComGF Machinery gene
  NDR85_RS12635 (NDR85_12610) comGE 2524133..2524480 (-) 348 WP_044154580.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=697552 NDR85_RS12590 WP_024122036.1 2519660..2519833(+) (sinI) [Bacillus halotolerans strain XE48]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=697552 NDR85_RS12590 WP_024122036.1 2519660..2519833(+) (sinI) [Bacillus halotolerans strain XE48]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947