Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   M0696_RS02185 Genome accession   NZ_CP096590
Coordinates   432383..432505 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus rugosus strain A78.1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 427383..437505
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  M0696_RS02170 (M0696_02170) yclJ 429003..429686 (+) 684 WP_003224983.1 two-component system response regulator YclJ -
  M0696_RS02175 (M0696_02175) - 429673..431088 (+) 1416 WP_248602435.1 HAMP domain-containing sensor histidine kinase -
  M0696_RS02180 (M0696_02180) rapC 431251..432399 (+) 1149 WP_222143543.1 response regulator aspartate phosphatase RapC Regulator
  M0696_RS02185 (M0696_02185) phrC 432383..432505 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  M0696_RS02190 (M0696_02190) - 432599..432706 (-) 108 WP_071578333.1 YjcZ family sporulation protein -
  M0696_RS02195 (M0696_02195) - 432857..434221 (-) 1365 WP_248602436.1 aspartate kinase -
  M0696_RS02200 (M0696_02200) ceuB 434607..435557 (+) 951 WP_248602437.1 petrobactin ABC transporter permease YclN Machinery gene
  M0696_RS02205 (M0696_02205) yclO 435550..436497 (+) 948 WP_248602438.1 petrobactin ABC transporter permease YclO -
  M0696_RS02210 (M0696_02210) yclP 436491..437249 (+) 759 WP_248602439.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=681927 M0696_RS02185 WP_003224994.1 432383..432505(+) (phrC) [Bacillus rugosus strain A78.1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=681927 M0696_RS02185 WP_003224994.1 432383..432505(+) (phrC) [Bacillus rugosus strain A78.1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCTGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACGGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1