Detailed information    

insolico Bioinformatically predicted

Overview

Name   recN   Type   Machinery gene
Locus tag   MRH55_RS04130 Genome accession   NZ_CP094378
Coordinates   785673..785870 (-) Length   65 a.a.
NCBI ID   WP_304985030.1    Uniprot ID   -
Organism   Coxiella-like endosymbiont isolate CLE RaCVSA     
Function   homologous recombination (predicted from homology)   
Homologous recombination

Genomic Context

Location: 780673..790870
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  MRH55_RS04080 - 781364..781516 (-) 153 WP_304985021.1 peptide-methionine (S)-S-oxide reductase -
  MRH55_RS07765 - 781479..781652 (-) 174 WP_369420972.1 peptide-methionine (S)-S-oxide reductase -
  MRH55_RS04085 - 781643..781849 (-) 207 WP_304985022.1 peptide-methionine (R)-S-oxide reductase -
  MRH55_RS04090 smpB 782055..782534 (-) 480 WP_304985023.1 SsrA-binding protein SmpB -
  MRH55_RS04095 - 782561..783004 (+) 444 WP_304985024.1 type II toxin-antitoxin system RatA family toxin -
  MRH55_RS04100 - 782997..783293 (+) 297 WP_304985025.1 RnfH family protein -
  MRH55_RS04105 bamE 783394..783528 (-) 135 WP_304985026.1 outer membrane protein assembly factor BamE -
  MRH55_RS04110 fur 783756..784184 (+) 429 WP_304986124.1 ferric iron uptake transcriptional regulator -
  MRH55_RS04115 - 784517..784708 (-) 192 WP_304985027.1 hypothetical protein -
  MRH55_RS04120 - 784693..784968 (-) 276 WP_304985028.1 hypothetical protein -
  MRH55_RS04125 - 785257..785409 (-) 153 WP_304985029.1 hypothetical protein -
  MRH55_RS04130 recN 785673..785870 (-) 198 WP_304985030.1 AAA family ATPase Machinery gene
  MRH55_RS04135 - 785848..786758 (-) 911 Protein_849 NAD(+) kinase -
  MRH55_RS04140 grpE 786891..787505 (+) 615 WP_304985031.1 nucleotide exchange factor GrpE -
  MRH55_RS04145 dnaK 788349..790315 (+) 1967 Protein_851 molecular chaperone DnaK -

Sequence

Protein


Download         Length: 65 a.a.        Molecular weight: 7043.08 Da        Isoelectric Point: 6.4458

>NTDB_id=669355 MRH55_RS04130 WP_304985030.1 785673..785870(-) (recN) [Coxiella-like endosymbiont isolate CLE RaCVSA]
MLTHTHIKNFTIVESITFDFEKGLTVLTGETGTGKSIIVDAVGLLLGGRRSDTALIRSSTEQCVY

Nucleotide


Download         Length: 198 bp        

>NTDB_id=669355 MRH55_RS04130 WP_304985030.1 785673..785870(-) (recN) [Coxiella-like endosymbiont isolate CLE RaCVSA]
ATGTTAACGCATACTCATATTAAAAATTTCACGATCGTTGAATCCATTACCTTTGACTTTGAAAAAGGCTTAACCGTATT
AACGGGTGAAACAGGCACAGGAAAGTCTATTATTGTGGATGCTGTTGGTTTATTGTTGGGTGGTCGAAGATCGGATACTG
CCCTAATCCGTTCCTCTACAGAACAGTGTGTATATTAG

Domains

Predicted by InterproScan.

AAA domain (AAA_23)

(6-53)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  recN Bacillus subtilis subsp. subtilis str. 168

66.667

78.462

0.523

Multiple sequence alignment