Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   BEST7003_RS02125 Genome accession   NZ_AP012496
Coordinates   429959..430081 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis BEST7003     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424959..435081
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BEST7003_RS02110 (BEST7003_0376) yclJ 426573..427256 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  BEST7003_RS02115 (BEST7003_0377) yclK 427243..428664 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  BEST7003_RS02120 (BEST7003_0378) rapC 428827..429975 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  BEST7003_RS02125 (BEST7003_0379) phrC 429959..430081 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BEST7003_RS21235 yczM 430181..430270 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  BEST7003_RS20290 yczN 430352..430465 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  BEST7003_RS02140 (BEST7003_0380) thrD 430619..431983 (-) 1365 WP_009966541.1 aspartate kinase -
  BEST7003_RS02145 (BEST7003_0381) ceuB 432368..433318 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  BEST7003_RS02150 (BEST7003_0382) yclO 433311..434258 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  BEST7003_RS02155 (BEST7003_0383) yclP 434252..435010 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=65217 BEST7003_RS02125 WP_003224994.1 429959..430081(+) (phrC) [Bacillus subtilis BEST7003]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=65217 BEST7003_RS02125 WP_003224994.1 429959..430081(+) (phrC) [Bacillus subtilis BEST7003]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment