NTDB

Overview

Name	comGE/cglE	Type	Machinery gene
Locus tag	L3475_RS09850	Genome accession	NZ_CP091451
Coordinates	1895321..1895623 (-)	Length	100 a.a.
NCBI ID	WP_000413380.1	Uniprot ID	-
Organism	Streptococcus pneumoniae strain 3238/09
Function	dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 1890321..1900623

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
L3475_RS09815 (L3475_09740)	rnpA	1891007..1891378 (-)	372	WP_000739246.1	ribonuclease P protein component	-
L3475_RS09820	-	1891395..1891526 (-)	132	WP_000768904.1	hypothetical protein	-
L3475_RS09825 (L3475_09745)	-	1891527..1892717 (-)	1191	WP_000167766.1	acetate kinase	-
L3475_RS09830 (L3475_09750)	comYH	1892768..1893721 (-)	954	WP_000345119.1	class I SAM-dependent methyltransferase	Machinery gene
L3475_RS09835 (L3475_09755)	-	1893782..1894369 (-)	588	WP_000679774.1	class I SAM-dependent methyltransferase	-
L3475_RS09840 (L3475_09760)	comGG/cglG	1894506..1894919 (-)	414	WP_000265630.1	competence type IV pilus minor pilin ComGG	Machinery gene
L3475_RS09845 (L3475_09765)	comGF/cglF	1894897..1895358 (-)	462	WP_000250545.1	competence type IV pilus minor pilin ComGF	Machinery gene
L3475_RS09850 (L3475_09770)	comGE/cglE	1895321..1895623 (-)	303	WP_000413380.1	competence type IV pilus minor pilin ComGE	Machinery gene
L3475_RS09855 (L3475_09775)	comGD/cglD	1895586..1895990 (-)	405	WP_000588005.1	competence type IV pilus minor pilin ComGD	Machinery gene
L3475_RS09860 (L3475_09780)	comGC/cglC	1895983..1896309 (-)	327	WP_263275209.1	comG operon protein ComGC	Machinery gene
L3475_RS09865 (L3475_09785)	comGB/cglB	1896311..1897327 (-)	1017	WP_013193332.1	competence type IV pilus assembly protein ComGB	Machinery gene
L3475_RS09870 (L3475_09790)	comGA/cglA/cilD	1897275..1898216 (-)	942	WP_000249567.1	competence type IV pilus ATPase ComGA	Machinery gene
L3475_RS09875 (L3475_09795)	-	1898292..1898657 (-)	366	WP_000286415.1	DUF1033 family protein	-
L3475_RS09880 (L3475_09800)	-	1898808..1899866 (-)	1059	WP_000649468.1	zinc-dependent alcohol dehydrogenase family protein	-

Sequence

Protein

Download Length: 100 a.a. Molecular weight: 11135.11 Da Isoelectric Point: 9.7273

                                >NTDB_id=651357 L3475_RS09850 WP_000413380.1 1895321..1895623(-) (comGE/cglE) [Streptococcus pneumoniae strain 3238/09]

MEKLNALRKQKIRAVILLEAVVALAIFASIATLLLGQIQKNRQEEAKILQKEEVLRVAKMALQTGQNQVNINGVEIQVFS

SEKGLEVYHGSEQLLAIKEP

Nucleotide

Download Length: 303 bp

                                >NTDB_id=651357 L3475_RS09850 WP_000413380.1 1895321..1895623(-) (comGE/cglE) [Streptococcus pneumoniae strain 3238/09]

ATGGAAAAATTAAACGCATTAAGGAAACAAAAAATTAGGGCAGTGATTTTACTGGAAGCAGTAGTCGCTCTAGCTATCTT

TGCCAGCATTGCGACCCTCCTTTTGGGACAAATTCAAAAAAATAGGCAAGAGGAAGCAAAAATCTTGCAAAAGGAAGAAG

TCTTGAGGGTAGCTAAGATGGCCTTGCAGACAGGTCAAAATCAGGTAAACATAAACGGAGTTGAGATTCAGGTGTTTTCT

AGCGAAAAGGGATTGGAGGTCTACCATGGTTCAGAACAGTTGTTGGCAATCAAAGAGCCATAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(16-97)

Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.

3D structure

Source	ID	Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.

Visualization of predicted probability:

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	H_a-value
comGE/cglE	Streptococcus mitis NCTC 12261	99	100	0.99
comGE/cglE	Streptococcus pneumoniae Rx1	99	100	0.99
comGE/cglE	Streptococcus pneumoniae D39	99	100	0.99
comGE/cglE	Streptococcus pneumoniae R6	99	100	0.99
comGE/cglE	Streptococcus pneumoniae TIGR4	99	100	0.99
comGE/cglE	Streptococcus mitis SK321	98	100	0.98
comYE	Streptococcus mutans UA140	43.333	90	0.39
comYE	Streptococcus mutans UA159	43.333	90	0.39

Detailed information NTG0651357