NTDB

Overview

Name	comGE/cglE	Type	Machinery gene
Locus tag	L1A15_RS00240	Genome accession	NZ_CP090884
Coordinates	38906..39208 (+)	Length	100 a.a.
NCBI ID	WP_000413382.1	Uniprot ID	-
Organism	Streptococcus pneumoniae strain MD5403
Function	dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 33906..44208

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
L1A15_RS00210 (L1A15_00210)	-	34663..35721 (+)	1059	WP_000649468.1	zinc-dependent alcohol dehydrogenase family protein	-
L1A15_RS00215 (L1A15_00215)	-	35872..36237 (+)	366	WP_000286415.1	DUF1033 family protein	-
L1A15_RS00220 (L1A15_00220)	comGA/cglA/cilD	36313..37254 (+)	942	WP_000249552.1	competence type IV pilus ATPase ComGA	Machinery gene
L1A15_RS00225 (L1A15_00225)	comGB/cglB	37202..38218 (+)	1017	WP_074017570.1	competence type IV pilus assembly protein ComGB	Machinery gene
L1A15_RS00230 (L1A15_00230)	comGC/cglC	38220..38546 (+)	327	WP_000738636.1	comG operon protein ComGC	Machinery gene
L1A15_RS00235 (L1A15_00235)	comGD/cglD	38539..38943 (+)	405	WP_000588013.1	competence type IV pilus minor pilin ComGD	Machinery gene
L1A15_RS00240 (L1A15_00240)	comGE/cglE	38906..39208 (+)	303	WP_000413382.1	competence type IV pilus minor pilin ComGE	Machinery gene
L1A15_RS00245 (L1A15_00245)	comGF/cglF	39171..39632 (+)	462	WP_000250542.1	competence type IV pilus minor pilin ComGF	Machinery gene
L1A15_RS00250 (L1A15_00250)	comGG/cglG	39610..40023 (+)	414	WP_000265624.1	competence type IV pilus minor pilin ComGG	Machinery gene
L1A15_RS00255 (L1A15_00255)	-	40160..40754 (+)	595	Protein_35	methyltransferase domain-containing protein	-
L1A15_RS00260 (L1A15_00260)	comYH	40815..41768 (+)	954	WP_000345099.1	class I SAM-dependent methyltransferase	Machinery gene
L1A15_RS00265 (L1A15_00265)	-	41819..43009 (+)	1191	WP_000167765.1	acetate kinase	-
L1A15_RS10350	-	43010..43141 (+)	132	WP_000768904.1	hypothetical protein	-
L1A15_RS00270 (L1A15_00270)	rnpA	43158..43529 (+)	372	WP_000739244.1	ribonuclease P protein component	-

Sequence

Protein

Download Length: 100 a.a. Molecular weight: 11108.08 Da Isoelectric Point: 9.7273

                                >NTDB_id=645734 L1A15_RS00240 WP_000413382.1 38906..39208(+) (comGE/cglE) [Streptococcus pneumoniae strain MD5403]

MEKLNALRKQKIRAVILLEAVVALAIFASIATLLLGQIQKNRQEEAKILQKEEVLRVAKMALQTGQNQVSINGVEIQVFS

SEKGLEVYHGSEQLLAIKEP

Nucleotide

Download Length: 303 bp

                                >NTDB_id=645734 L1A15_RS00240 WP_000413382.1 38906..39208(+) (comGE/cglE) [Streptococcus pneumoniae strain MD5403]

ATGGAAAAATTAAACGCATTAAGGAAACAAAAAATTAGGGCAGTGATTTTACTGGAAGCAGTAGTCGCTCTAGCTATCTT

TGCCAGCATTGCGACCCTCCTTTTGGGACAAATTCAAAAAAATAGGCAAGAGGAAGCAAAAATCTTGCAAAAGGAAGAAG

TCTTGAGGGTAGCTAAGATGGCCCTGCAGACGGGGCAAAATCAGGTAAGCATCAACGGAGTTGAGATTCAGGTATTTTCT

AGTGAAAAAGGATTGGAGGTCTACCATGGTTCAGAACAGTTGTTGGCAATCAAAGAGCCATAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(16-97)

Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.

3D structure

Source	ID	Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.

Visualization of predicted probability:

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	H_a-value
comGE/cglE	Streptococcus pneumoniae Rx1	100	100	1
comGE/cglE	Streptococcus pneumoniae D39	100	100	1
comGE/cglE	Streptococcus pneumoniae R6	100	100	1
comGE/cglE	Streptococcus pneumoniae TIGR4	100	100	1
comGE/cglE	Streptococcus mitis NCTC 12261	98	100	0.98
comGE/cglE	Streptococcus mitis SK321	98	100	0.98
comYE	Streptococcus mutans UA140	44.444	90	0.4
comYE	Streptococcus mutans UA159	44.444	90	0.4

Detailed information NTG0645734