Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   LUV29_RS02185 Genome accession   NZ_CP089592
Coordinates   434562..434684 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain Bsi     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 429562..439684
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LUV29_RS02170 (LUV29_02170) yclJ 431176..431859 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  LUV29_RS02175 (LUV29_02175) yclK 431846..433267 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  LUV29_RS02180 (LUV29_02180) rapC 433430..434578 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  LUV29_RS02185 (LUV29_02185) phrC 434562..434684 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  LUV29_RS02190 (LUV29_02190) yczM 434784..434873 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  LUV29_RS02195 (LUV29_02195) yczN 434955..435068 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  LUV29_RS02200 (LUV29_02200) thrD 435222..436586 (-) 1365 WP_003234493.1 aspartate kinase -
  LUV29_RS02205 (LUV29_02205) ceuB 436971..437921 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  LUV29_RS02210 (LUV29_02210) yclO 437914..438861 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  LUV29_RS02215 (LUV29_02215) yclP 438855..439613 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=638187 LUV29_RS02185 WP_003224994.1 434562..434684(+) (phrC) [Bacillus subtilis strain Bsi]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=638187 LUV29_RS02185 WP_003224994.1 434562..434684(+) (phrC) [Bacillus subtilis strain Bsi]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1