Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   U712_RS02125 Genome accession   NC_022898
Coordinates   429955..430077 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis PY79     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424955..435077
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  U712_RS02110 (U712_01940) yclJ 426569..427252 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  U712_RS02115 (U712_01945) yclK 427239..428660 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  U712_RS02120 (U712_01950) rapC 428823..429971 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  U712_RS02125 (U712_01955) phrC 429955..430077 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  U712_RS20210 (U712_01960) yczM 430177..430266 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  U712_RS20215 (U712_01965) yczN 430348..430461 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  U712_RS02140 (U712_01970) thrD 430615..431979 (-) 1365 WP_009966541.1 aspartate kinase -
  U712_RS02145 (U712_01975) ceuB 432364..433314 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  U712_RS02150 (U712_01980) yclO 433307..434254 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  U712_RS02155 (U712_01985) yclP 434248..435006 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=63714 U712_RS02125 WP_003224994.1 429955..430077(+) (phrC) [Bacillus subtilis PY79]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=63714 U712_RS02125 WP_003224994.1 429955..430077(+) (phrC) [Bacillus subtilis PY79]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment