Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   LL047_RS11525 Genome accession   NZ_CP086072
Coordinates   2245480..2245776 (-) Length   98 a.a.
NCBI ID   WP_010906316.1    Uniprot ID   A0A3N6L9Y1
Organism   Lactococcus lactis subsp. lactis strain EIP33     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2240480..2250776
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LL047_RS11490 (LL047_11455) - 2240770..2241636 (+) 867 WP_010906309.1 RluA family pseudouridine synthase -
  LL047_RS11495 (LL047_11460) - 2241675..2242484 (-) 810 WP_010906310.1 metal ABC transporter permease -
  LL047_RS11500 (LL047_11465) - 2242477..2243214 (-) 738 WP_010906311.1 metal ABC transporter ATP-binding protein -
  LL047_RS11505 (LL047_11470) - 2243391..2244233 (-) 843 WP_010906312.1 metal ABC transporter substrate-binding protein -
  LL047_RS11510 (LL047_11475) - 2244230..2244667 (-) 438 WP_010906313.1 zinc-dependent MarR family transcriptional regulator -
  LL047_RS11515 (LL047_11480) comGG 2244748..2245032 (-) 285 WP_010906314.1 competence type IV pilus minor pilin ComGG Machinery gene
  LL047_RS11520 (LL047_11485) comGF 2245071..2245517 (-) 447 WP_031296844.1 competence type IV pilus minor pilin ComGF Machinery gene
  LL047_RS11525 (LL047_11490) comGE 2245480..2245776 (-) 297 WP_010906316.1 competence type IV pilus minor pilin ComGE Machinery gene
  LL047_RS11530 (LL047_11495) comGD 2245748..2246146 (-) 399 WP_021214886.1 competence type IV pilus minor pilin ComGD Machinery gene
  LL047_RS11535 (LL047_11500) comGC 2246139..2246522 (-) 384 WP_010906318.1 competence type IV pilus major pilin ComGC Machinery gene
  LL047_RS11540 (LL047_11505) comGB 2246536..2247609 (-) 1074 WP_010906319.1 competence type IV pilus assembly protein ComGB Machinery gene
  LL047_RS11545 (LL047_11510) comGA 2247503..2248441 (-) 939 WP_010906320.1 competence type IV pilus ATPase ComGA Machinery gene

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 11076.95 Da        Isoelectric Point: 6.4684

>NTDB_id=622352 LL047_RS11525 WP_010906316.1 2245480..2245776(-) (comGE) [Lactococcus lactis subsp. lactis strain EIP33]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=622352 LL047_RS11525 WP_010906316.1 2245480..2245776(-) (comGE) [Lactococcus lactis subsp. lactis strain EIP33]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB A0A3N6L9Y1

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

68.041

98.98

0.673