Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   K0V03_RS12900 Genome accession   NZ_CP080508
Coordinates   2441956..2442078 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain HD15     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2436956..2447078
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  K0V03_RS12885 (K0V03_12885) yclJ 2438570..2439253 (+) 684 WP_032722955.1 two-component system response regulator YclJ -
  K0V03_RS12890 (K0V03_12890) yclK 2439240..2440661 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  K0V03_RS12895 (K0V03_12895) rapC 2440824..2441972 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  K0V03_RS12900 (K0V03_12900) phrC 2441956..2442078 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  K0V03_RS12905 (K0V03_12905) yczM 2442178..2442267 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  K0V03_RS12910 (K0V03_12910) yczN 2442349..2442462 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  K0V03_RS12915 (K0V03_12915) thrD 2442615..2443979 (-) 1365 WP_015715246.1 aspartate kinase -
  K0V03_RS12920 (K0V03_12920) ceuB 2444364..2445314 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  K0V03_RS12925 (K0V03_12925) yclO 2445307..2446254 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  K0V03_RS12930 (K0V03_12930) yclP 2446248..2447006 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=593330 K0V03_RS12900 WP_003224994.1 2441956..2442078(+) (phrC) [Bacillus subtilis strain HD15]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=593330 K0V03_RS12900 WP_003224994.1 2441956..2442078(+) (phrC) [Bacillus subtilis strain HD15]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1