Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   MTO79_RS12385 Genome accession   NZ_CP094474
Coordinates   2422840..2423136 (-) Length   98 a.a.
NCBI ID   WP_010906316.1    Uniprot ID   Q9CDU2
Organism   Lactococcus lactis strain SCB469     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2417840..2428136
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  MTO79_RS12350 (MTO79_12350) - 2417953..2418762 (-) 810 WP_014570791.1 metal ABC transporter permease -
  MTO79_RS12355 (MTO79_12355) - 2418755..2419492 (-) 738 WP_058221575.1 metal ABC transporter ATP-binding protein -
  MTO79_RS12360 (MTO79_12360) - 2419669..2420511 (-) 843 WP_003129990.1 metal ABC transporter substrate-binding protein -
  MTO79_RS12365 (MTO79_12365) - 2420508..2420945 (-) 438 WP_003129992.1 zinc-dependent MarR family transcriptional regulator -
  MTO79_RS12370 (MTO79_12370) - 2421152..2422099 (+) 948 WP_003130410.1 IS30 family transposase -
  MTO79_RS12375 (MTO79_12375) comGG 2422073..2422399 (-) 327 WP_058221568.1 competence type IV pilus minor pilin ComGG Machinery gene
  MTO79_RS12380 (MTO79_12380) comGF 2422449..2422877 (-) 429 Protein_2393 competence type IV pilus minor pilin ComGF -
  MTO79_RS12385 (MTO79_12385) comGE 2422840..2423136 (-) 297 WP_010906316.1 competence type IV pilus minor pilin ComGE Machinery gene
  MTO79_RS12390 (MTO79_12390) comGD 2423108..2423539 (-) 432 WP_080585155.1 competence type IV pilus minor pilin ComGD Machinery gene
  MTO79_RS12395 (MTO79_12395) comGC 2423499..2423768 (-) 270 WP_003129998.1 competence type IV pilus major pilin ComGC Machinery gene
  MTO79_RS12400 (MTO79_12400) - 2423895..2424587 (-) 693 WP_152994386.1 hypothetical protein -
  MTO79_RS12405 (MTO79_12405) - 2424829..2425608 (-) 780 WP_082225220.1 peptidoglycan amidohydrolase family protein -
  MTO79_RS12410 (MTO79_12410) - 2425608..2425907 (-) 300 WP_031559226.1 phage holin -
  MTO79_RS12415 (MTO79_12415) - 2425920..2426270 (-) 351 WP_014570798.1 hypothetical protein -
  MTO79_RS12420 (MTO79_12420) - 2426283..2426519 (-) 237 WP_082225257.1 hypothetical protein -

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 11076.95 Da        Isoelectric Point: 6.4684

>NTDB_id=577953 MTO79_RS12385 WP_010906316.1 2422840..2423136(-) (comGE) [Lactococcus lactis strain SCB469]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=577953 MTO79_RS12385 WP_010906316.1 2422840..2423136(-) (comGE) [Lactococcus lactis strain SCB469]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA

Domains

Predicted by InterProScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB Q9CDU2

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

68.041

98.98

0.673