Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   KP952_RS02135 Genome accession   NZ_CP076731
Coordinates   426578..426700 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain Miz-8     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 421578..431700
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KP952_RS02120 (KP952_02120) yclJ 423191..423874 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  KP952_RS02125 (KP952_02125) yclK 423861..425282 (+) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  KP952_RS02130 (KP952_02130) rapC 425446..426594 (+) 1149 WP_069837255.1 response regulator aspartate phosphatase RapC Regulator
  KP952_RS02135 (KP952_02135) phrC 426578..426700 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  KP952_RS02140 (KP952_02140) yczM 426799..426888 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  KP952_RS02145 (KP952_02145) yczN 426970..427083 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  KP952_RS02150 (KP952_02150) thrD 427236..428600 (-) 1365 WP_021481755.1 aspartate kinase -
  KP952_RS02155 (KP952_02155) ceuB 428991..429941 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  KP952_RS02160 (KP952_02160) yclO 429934..430881 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  KP952_RS02165 (KP952_02165) yclP 430875..431633 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=577731 KP952_RS02135 WP_003224994.1 426578..426700(+) (phrC) [Bacillus subtilis subsp. subtilis strain Miz-8]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=577731 KP952_RS02135 WP_003224994.1 426578..426700(+) (phrC) [Bacillus subtilis subsp. subtilis strain Miz-8]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1