Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   I653_RS02060 Genome accession   NC_020832
Coordinates   421045..421167 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis str. BAB-1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 416045..426167
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  I653_RS02045 (I653_01895) yclJ 417658..418341 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  I653_RS02050 (I653_01900) yclK 418328..419749 (+) 1422 WP_080109028.1 two-component system sensor histidine kinase YclK -
  I653_RS02055 (I653_01905) rapC 419913..421061 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  I653_RS02060 (I653_01910) phrC 421045..421167 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  I653_RS20055 (I653_01915) yczM 421267..421356 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  I653_RS20060 (I653_01920) yczN 421438..421551 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  I653_RS02075 (I653_01925) thrD 421704..423068 (-) 1365 WP_015382767.1 aspartate kinase -
  I653_RS02080 (I653_01930) ceuB 423453..424403 (+) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  I653_RS02085 (I653_01935) yclO 424396..425343 (+) 948 WP_015482795.1 petrobactin ABC transporter permease YclO -
  I653_RS02090 (I653_01940) yclP 425337..426095 (+) 759 WP_015482796.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=57491 I653_RS02060 WP_003224994.1 421045..421167(+) (phrC) [Bacillus subtilis subsp. subtilis str. BAB-1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=57491 I653_RS02060 WP_003224994.1 421045..421167(+) (phrC) [Bacillus subtilis subsp. subtilis str. BAB-1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment