Detailed information
Overview
| Name | comS | Type | Regulator |
| Locus tag | - | Genome accession | NZ_AJTZ01000004 |
| Coordinates | 24587..24637 (-) | Length | 17 a.a. |
| NCBI ID | - | Uniprot ID | - |
| Organism | Streptococcus ratti FA-1 = DSM 20564 strain FA-1 | ||
| Function | activate transcription of comX; activate transcription of comS (predicted from homology) Competence regulation |
||
Genomic Context
Location: 19587..29637
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| SRA_RS01740 (SRA_01799) | - | 20679..22463 (-) | 1785 | WP_003086923.1 | acyltransferase family protein | - |
| SRA_RS01745 (SRA_01804) | - | 22460..22840 (-) | 381 | WP_003090541.1 | hypothetical protein | - |
| SRA_RS01750 (SRA_01809) | - | 22907..23329 (-) | 423 | WP_003086927.1 | low molecular weight protein-tyrosine-phosphatase | - |
| SRA_RS01755 (SRA_01814) | ruvB | 23360..24361 (-) | 1002 | WP_003086929.1 | Holliday junction branch migration DNA helicase RuvB | Machinery gene |
| - | comS | 24587..24637 (-) | 51 | - | - | Regulator |
| SRA_RS01760 (SRA_01824) | comR | 24706..25620 (-) | 915 | WP_003090542.1 | helix-turn-helix domain-containing protein | Regulator |
| SRA_RS01765 (SRA_01829) | purB | 25761..27059 (-) | 1299 | WP_003086936.1 | adenylosuccinate lyase | - |
| SRA_RS01770 (SRA_01834) | - | 27063..27860 (-) | 798 | WP_225310761.1 | hypothetical protein | - |
| SRA_RS10510 | - | 27883..27936 (-) | 54 | WP_162129578.1 | hypothetical protein | - |
| SRA_RS01775 (SRA_01839) | - | 27938..28339 (-) | 402 | WP_003086941.1 | SRPBCC family protein | - |
| SRA_RS01780 (SRA_01844) | - | 28372..28983 (-) | 612 | WP_003086942.1 | CPBP family intramembrane glutamic endopeptidase | - |
Sequence
Protein
Download Length: 17 a.a. Molecular weight: 1980.36 Da Isoelectric Point: 5.7900
>NTDB_id=560 24587..24637(-) (comS) [Streptococcus ratti FA-1 = DSM 20564 strain FA-1]
MATIFSTVLRALDWWGI
MATIFSTVLRALDWWGI
Nucleotide
Download Length: 51 bp
>NTDB_id=560 24587..24637(-) (comS) [Streptococcus ratti FA-1 = DSM 20564 strain FA-1]
ATGGCTACCATTTTTTCAACCGTTTTAAGAGCTCTTGACTGGTGGGGAATC
ATGGCTACCATTTTTTCAACCGTTTTAAGAGCTCTTGACTGGTGGGGAATC
XIP
This gene is known to encode the precursor of σX inducing peptide (XIP), which involves in competence development. The mature XIP sequence is displayed as below:
ALDWWGI
Domains
No domain identified.
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comS | Streptococcus mutans UA159 |
41.176 |
100 |
0.412 |