Detailed information    

insolico Bioinformatically predicted

Overview


Name   comS   Type   Regulator
Locus tag   - Genome accession   NZ_AJTZ01000004
Coordinates   24587..24637 (-) Length   17 a.a.
NCBI ID   - Uniprot ID   -
Organism   Streptococcus ratti FA-1 = DSM 20564 strain FA-1     
Function   activate transcription of comX; activate transcription of comS (predicted from homology)   
Competence regulation

Genomic Context


Location: 19587..29637
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  SRA_RS01740 (SRA_01799) - 20679..22463 (-) 1785 WP_003086923.1 acyltransferase family protein -
  SRA_RS01745 (SRA_01804) - 22460..22840 (-) 381 WP_003090541.1 hypothetical protein -
  SRA_RS01750 (SRA_01809) - 22907..23329 (-) 423 WP_003086927.1 low molecular weight protein-tyrosine-phosphatase -
  SRA_RS01755 (SRA_01814) ruvB 23360..24361 (-) 1002 WP_003086929.1 Holliday junction branch migration DNA helicase RuvB Machinery gene
  - comS 24587..24637 (-) 51 - - Regulator
  SRA_RS01760 (SRA_01824) comR 24706..25620 (-) 915 WP_003090542.1 helix-turn-helix domain-containing protein Regulator
  SRA_RS01765 (SRA_01829) purB 25761..27059 (-) 1299 WP_003086936.1 adenylosuccinate lyase -
  SRA_RS01770 (SRA_01834) - 27063..27860 (-) 798 WP_225310761.1 hypothetical protein -
  SRA_RS10510 - 27883..27936 (-) 54 WP_162129578.1 hypothetical protein -
  SRA_RS01775 (SRA_01839) - 27938..28339 (-) 402 WP_003086941.1 SRPBCC family protein -
  SRA_RS01780 (SRA_01844) - 28372..28983 (-) 612 WP_003086942.1 CPBP family intramembrane glutamic endopeptidase -

Sequence


Protein


Download         Length: 17 a.a.        Molecular weight: 1980.36 Da        Isoelectric Point: 5.7900

>NTDB_id=560 24587..24637(-) (comS) [Streptococcus ratti FA-1 = DSM 20564 strain FA-1]
MATIFSTVLRALDWWGI

Nucleotide


Download         Length: 51 bp        

>NTDB_id=560 24587..24637(-) (comS) [Streptococcus ratti FA-1 = DSM 20564 strain FA-1]
ATGGCTACCATTTTTTCAACCGTTTTAAGAGCTCTTGACTGGTGGGGAATC

XIP


This gene is known to encode the precursor of σX inducing peptide (XIP), which involves in competence development. The mature XIP sequence is displayed as below:

ALDWWGI


Domains



No domain identified.



Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comS Streptococcus mutans UA159

41.176

100

0.412


Multiple sequence alignment