Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   LL229_RS11965 Genome accession   NZ_CP090823
Coordinates   2292597..2292893 (-) Length   98 a.a.
NCBI ID   WP_010906316.1    Uniprot ID   Q9CDU2
Organism   Lactococcus lactis subsp. lactis strain 229     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2287597..2297893
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LL229_RS11930 (LL229_2269) - 2287887..2288753 (+) 867 WP_010906309.1 RluA family pseudouridine synthase -
  LL229_RS11935 (LL229_2270) - 2288792..2289601 (-) 810 WP_010906310.1 metal ABC transporter permease -
  LL229_RS11940 (LL229_2271) - 2289594..2290331 (-) 738 WP_010906311.1 metal ABC transporter ATP-binding protein -
  LL229_RS11945 (LL229_2272) - 2290508..2291350 (-) 843 WP_010906312.1 metal ABC transporter substrate-binding protein -
  LL229_RS11950 (LL229_2273) - 2291347..2291784 (-) 438 WP_010906313.1 zinc-dependent MarR family transcriptional regulator -
  LL229_RS11955 (LL229_2274) comGG 2291865..2292149 (-) 285 WP_010906314.1 competence type IV pilus minor pilin ComGG Machinery gene
  LL229_RS11960 (LL229_2275) comGF 2292188..2292634 (-) 447 WP_031296844.1 competence type IV pilus minor pilin ComGF Machinery gene
  LL229_RS11965 (LL229_2276) comGE 2292597..2292893 (-) 297 WP_010906316.1 competence type IV pilus minor pilin ComGE Machinery gene
  LL229_RS11970 (LL229_2277) comGD 2292865..2293281 (-) 417 WP_021216554.1 competence type IV pilus minor pilin ComGD Machinery gene
  LL229_RS11975 (LL229_2278) comGC 2293256..2293525 (-) 270 WP_023349160.1 competence type IV pilus major pilin ComGC Machinery gene
  LL229_RS11980 (LL229_2279) - 2293686..2294423 (-) 738 WP_081172231.1 hypothetical protein -
  LL229_RS11985 (LL229_2281) - 2294627..2295406 (-) 780 WP_081172233.1 peptidoglycan amidohydrolase family protein -
  LL229_RS11990 (LL229_2282) - 2295406..2295693 (-) 288 WP_010905390.1 phage holin -
  LL229_RS11995 (LL229_03420) - 2295680..2296006 (-) 327 WP_010905389.1 hypothetical protein -

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 11076.95 Da        Isoelectric Point: 6.4684

>NTDB_id=555518 LL229_RS11965 WP_010906316.1 2292597..2292893(-) (comGE) [Lactococcus lactis subsp. lactis strain 229]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=555518 LL229_RS11965 WP_010906316.1 2292597..2292893(-) (comGE) [Lactococcus lactis subsp. lactis strain 229]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA

Domains

Predicted by InterProScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB Q9CDU2

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

68.041

98.98

0.673