Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   LRO88_RS02415 Genome accession   NZ_CP089148
Coordinates   464959..465081 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain NIB353     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 459959..470081
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LRO88_RS02400 yclJ 461573..462256 (+) 684 WP_128422071.1 two-component system response regulator YclJ -
  LRO88_RS02405 yclK 462243..463664 (+) 1422 WP_153952928.1 two-component system sensor histidine kinase YclK -
  LRO88_RS02410 rapC 463827..464975 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  LRO88_RS02415 phrC 464959..465081 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  LRO88_RS02420 yczM 465181..465270 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  LRO88_RS02425 yczN 465352..465465 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  LRO88_RS02430 thrD 465619..466983 (-) 1365 WP_106074063.1 aspartate kinase -
  LRO88_RS02435 ceuB 467368..468318 (+) 951 WP_159376646.1 petrobactin ABC transporter permease YclN Machinery gene
  LRO88_RS02440 yclO 468311..469258 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  LRO88_RS02445 yclP 469252..470010 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=548910 LRO88_RS02415 WP_003224994.1 464959..465081(+) (phrC) [Bacillus subtilis strain NIB353]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=548910 LRO88_RS02415 WP_003224994.1 464959..465081(+) (phrC) [Bacillus subtilis strain NIB353]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1