Detailed information    

insolico Bioinformatically predicted

Overview


Name   comGE   Type   Machinery gene
Locus tag   J3S98_RS03210 Genome accession   NZ_CP071729
Coordinates   669141..669377 (+) Length   78 a.a.
NCBI ID   WP_014573335.1    Uniprot ID   -
Organism   Lactococcus cremoris strain FM-YL11     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Related MGE


Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type MGE coordinates Gene coordinates Relative position Distance (bp)
ICE 670189..674649 669141..669377 flank 812


Gene organization within MGE regions


Location: 669141..674649
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  J3S98_RS03210 (J3S98_03210) comGE 669141..669377 (+) 237 WP_014573335.1 competence type IV pilus minor pilin ComGE Machinery gene
  J3S98_RS03215 (J3S98_03215) comGF 669340..669786 (+) 447 WP_011836043.1 competence type IV pilus minor pilin ComGF Machinery gene
  J3S98_RS03220 (J3S98_03220) comGG 669882..670109 (+) 228 WP_228764408.1 competence protein ComGG Machinery gene
  J3S98_RS03225 (J3S98_03225) - 670189..670626 (+) 438 WP_011677180.1 zinc-dependent MarR family transcriptional regulator -
  J3S98_RS03230 (J3S98_03230) - 670623..671465 (+) 843 WP_021164979.1 zinc ABC transporter substrate-binding protein -
  J3S98_RS03235 (J3S98_03235) - 671644..672381 (+) 738 WP_011677178.1 metal ABC transporter ATP-binding protein -
  J3S98_RS03240 (J3S98_03240) - 672374..673183 (+) 810 WP_011677177.1 metal ABC transporter permease -
  J3S98_RS03245 (J3S98_03245) - 673256..674649 (+) 1394 WP_207873735.1 IS3 family transposase -

Sequence


Protein


Download         Length: 78 a.a.        Molecular weight: 8700.94 Da        Isoelectric Point: 4.3885

>NTDB_id=547286 J3S98_RS03210 WP_014573335.1 669141..669377(+) (comGE) [Lactococcus cremoris strain FM-YL11]
MALLSFLVTFLLSALTNSRQQEVQENQQIESLNVAQMAIESQLMELSLNGSVIKIRQDSTATIISDHGKEILRLEAQN

Nucleotide


Download         Length: 237 bp        

>NTDB_id=547286 J3S98_RS03210 WP_014573335.1 669141..669377(+) (comGE) [Lactococcus cremoris strain FM-YL11]
ATGGCATTATTGAGCTTTTTGGTCACTTTTCTCTTAAGTGCTCTTACTAATTCTCGTCAGCAAGAGGTACAAGAAAATCA
ACAAATTGAGTCCTTAAATGTAGCTCAGATGGCAATAGAAAGTCAGCTGATGGAACTATCGTTAAATGGTTCTGTTATAA
AAATAAGACAAGATTCGACTGCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

96.154

100

0.962