Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   JQX68_RS02145 Genome accession   NZ_CP070483
Coordinates   428632..428754 (+) Length   40 a.a.
NCBI ID   WP_014662771.1    Uniprot ID   A0A292GN16
Organism   Bacillus sp. LJBS06     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 423632..433754
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  JQX68_RS02130 (JQX68_02130) yclJ 425246..425929 (+) 684 WP_041521471.1 two-component system response regulator YclJ -
  JQX68_RS02135 (JQX68_02135) yclK 425916..427337 (+) 1422 WP_205440501.1 two-component system sensor histidine kinase YclK -
  JQX68_RS02140 (JQX68_02140) rapC 427500..428648 (+) 1149 WP_014662770.1 response regulator aspartate phosphatase RapC Regulator
  JQX68_RS02145 (JQX68_02145) phrC 428632..428754 (+) 123 WP_014662771.1 phosphatase RapC inhibitor PhrC Regulator
  JQX68_RS02150 (JQX68_02150) - 428852..428962 (-) 111 WP_040084173.1 YjcZ family sporulation protein -
  JQX68_RS02155 (JQX68_02155) - 429105..430469 (-) 1365 WP_136654856.1 aspartate kinase -
  JQX68_RS02160 (JQX68_02160) ceuB 430854..431804 (+) 951 WP_069148952.1 petrobactin ABC transporter permease YclN Machinery gene
  JQX68_RS02165 (JQX68_02165) yclO 431797..432744 (+) 948 WP_040084169.1 petrobactin ABC transporter permease YclO -
  JQX68_RS02170 (JQX68_02170) yclP 432738..433496 (+) 759 WP_014662775.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4221.02 Da        Isoelectric Point: 8.0579

>NTDB_id=539983 JQX68_RS02145 WP_014662771.1 428632..428754(+) (phrC) [Bacillus sp. LJBS06]
MKLKSKLFVICLAAAAIFTAAGVSAHAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=539983 JQX68_RS02145 WP_014662771.1 428632..428754(+) (phrC) [Bacillus sp. LJBS06]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTAGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTCATGC
GGAAGCACTCGACTTTCATGTGACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB A0A292GN16

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

97.5

100

0.975