Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   JR441_RS02120 Genome accession   NZ_CP069789
Coordinates   419955..420077 (+) Length   40 a.a.
NCBI ID   WP_198878977.1    Uniprot ID   -
Organism   Bacillus subtilis strain BIM B-569G     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 414955..425077
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  JR441_RS02105 (JR441_02105) yclJ 416568..417251 (+) 684 WP_204551422.1 response regulator transcription factor -
  JR441_RS02110 (JR441_02110) yclK 417238..418659 (+) 1422 WP_086343454.1 two-component system sensor histidine kinase YclK -
  JR441_RS02115 (JR441_02115) rapC 418823..419971 (+) 1149 WP_024571686.1 response regulator aspartate phosphatase RapC Regulator
  JR441_RS02120 (JR441_02120) phrC 419955..420077 (+) 123 WP_198878977.1 phosphatase RapC inhibitor PhrC Regulator
  JR441_RS02125 (JR441_02125) yczM 420177..420266 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  JR441_RS02130 (JR441_02130) yczN 420348..420461 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  JR441_RS02135 (JR441_02135) thrD 420614..421978 (-) 1365 WP_198878978.1 aspartate kinase -
  JR441_RS02140 (JR441_02140) ceuB 422363..423313 (+) 951 WP_088325307.1 petrobactin ABC transporter permease YclN Machinery gene
  JR441_RS02145 (JR441_02145) yclO 423306..424253 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  JR441_RS02150 (JR441_02150) yclP 424247..425005 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4226.04 Da        Isoelectric Point: 8.0285

>NTDB_id=536584 JR441_RS02120 WP_198878977.1 419955..420077(+) (phrC) [Bacillus subtilis strain BIM B-569G]
MKLKSKLFVICLAAAAIFTAAGVSANAEVLDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=536584 JR441_RS02120 WP_198878977.1 419955..420077(+) (phrC) [Bacillus subtilis strain BIM B-569G]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGTGCTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

97.5

100

0.975