Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   B657_RS02205 Genome accession   NC_018520
Coordinates   429974..430096 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis QB928     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424974..435096
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  B657_RS02190 (B657_03750) yclJ 426588..427271 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  B657_RS02195 (B657_03760) yclK 427258..428679 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  B657_RS02200 (B657_03770) rapC 428842..429990 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  B657_RS02205 phrC 429974..430096 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  B657_RS21810 yczM 430196..430285 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  B657_RS02215 (B657_03789) yczN 430367..430480 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  B657_RS02220 (B657_03790) thrD 430634..431998 (-) 1365 WP_009966541.1 aspartate kinase -
  B657_RS02225 (B657_03800) ceuB 432383..433333 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  B657_RS02230 (B657_03810) yclO 433326..434273 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  B657_RS02235 (B657_03820) yclP 434267..435025 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=52567 B657_RS02205 WP_003224994.1 429974..430096(+) (phrC) [Bacillus subtilis QB928]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=52567 B657_RS02205 WP_003224994.1 429974..430096(+) (phrC) [Bacillus subtilis QB928]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment