Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   MY9_RS02155 Genome accession   NC_017743
Coordinates   425609..425731 (+) Length   40 a.a.
NCBI ID   WP_014662771.1    Uniprot ID   A0A292GN16
Organism   Bacillus sp. JS     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 420609..430731
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  MY9_RS02140 (MY9_0391) yclJ 422223..422906 (+) 684 WP_041521471.1 two-component system response regulator YclJ -
  MY9_RS02145 (MY9_0392) yclK 422893..424314 (+) 1422 WP_081483592.1 two-component system sensor histidine kinase YclK -
  MY9_RS02150 (MY9_0393) rapC 424477..425625 (+) 1149 WP_014662770.1 response regulator aspartate phosphatase RapC Regulator
  MY9_RS02155 (MY9_0394) phrC 425609..425731 (+) 123 WP_014662771.1 phosphatase RapC inhibitor PhrC Regulator
  MY9_RS02160 - 425829..425939 (-) 111 WP_040084173.1 YjcZ family sporulation protein -
  MY9_RS02165 (MY9_0395) - 426082..427446 (-) 1365 WP_014662772.1 aspartate kinase -
  MY9_RS02170 (MY9_0396) ceuB 427831..428781 (+) 951 WP_014662773.1 petrobactin ABC transporter permease YclN Machinery gene
  MY9_RS02175 (MY9_0397) yclO 428774..429721 (+) 948 WP_014662774.1 petrobactin ABC transporter permease YclO -
  MY9_RS02180 (MY9_0398) yclP 429715..430473 (+) 759 WP_014662775.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4221.02 Da        Isoelectric Point: 8.0579

>NTDB_id=50580 MY9_RS02155 WP_014662771.1 425609..425731(+) (phrC) [Bacillus sp. JS]
MKLKSKLFVICLAAAAIFTAAGVSAHAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=50580 MY9_RS02155 WP_014662771.1 425609..425731(+) (phrC) [Bacillus sp. JS]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTAGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTCATGC
GGAAGCACTCGACTTTCATGTGACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB A0A292GN16

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

97.5

100

0.975

Multiple sequence alignment