Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   ITP52_RS08435 Genome accession   NZ_CP064818
Coordinates   1693432..1693554 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SH1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 1688432..1698554
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ITP52_RS08405 (ITP52_08405) yclP 1688501..1689259 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  ITP52_RS08410 (ITP52_08410) yclO 1689253..1690200 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ITP52_RS08415 (ITP52_08415) ceuB 1690193..1691143 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ITP52_RS08420 (ITP52_08420) thrD 1691528..1692892 (+) 1365 WP_043940054.1 aspartate kinase -
  ITP52_RS08425 (ITP52_08425) yczN 1693046..1693159 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  ITP52_RS08430 (ITP52_08430) yczM 1693241..1693330 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  ITP52_RS08435 (ITP52_08435) phrC 1693432..1693554 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ITP52_RS08440 (ITP52_08440) rapC 1693538..1694686 (-) 1149 WP_043940053.1 response regulator aspartate phosphatase RapC Regulator
  ITP52_RS08445 (ITP52_08445) yclK 1694850..1696271 (-) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  ITP52_RS08450 (ITP52_08450) yclJ 1696258..1696941 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=504891 ITP52_RS08435 WP_003224994.1 1693432..1693554(-) (phrC) [Bacillus subtilis strain SH1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=504891 ITP52_RS08435 WP_003224994.1 1693432..1693554(-) (phrC) [Bacillus subtilis strain SH1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1