Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   IRJ28_RS16950 Genome accession   NZ_CP064096
Coordinates   3209240..3209362 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain N1142-3at     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 3204240..3214362
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  IRJ28_RS16920 yclP 3204311..3205069 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  IRJ28_RS16925 yclO 3205063..3206010 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  IRJ28_RS16930 ceuB 3206003..3206953 (-) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  IRJ28_RS16935 thrD 3207338..3208702 (+) 1365 WP_003234493.1 aspartate kinase -
  IRJ28_RS16940 yczN 3208856..3208969 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  IRJ28_RS16945 yczM 3209051..3209140 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  IRJ28_RS16950 phrC 3209240..3209362 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  IRJ28_RS16955 rapC 3209346..3210494 (-) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  IRJ28_RS16960 yclK 3210657..3212078 (-) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  IRJ28_RS16965 yclJ 3212065..3212748 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=499500 IRJ28_RS16950 WP_003224994.1 3209240..3209362(-) (phrC) [Bacillus subtilis strain N1142-3at]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=499500 IRJ28_RS16950 WP_003224994.1 3209240..3209362(-) (phrC) [Bacillus subtilis strain N1142-3at]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1