NTDB

Overview

Name	pilB	Type	Machinery gene
Locus tag	H8Z71_RS05240	Genome accession	NZ_CP060465
Coordinates	1227170..1227289 (+)	Length	39 a.a.
NCBI ID	WP_005915819.1	Uniprot ID	A0A7S6YV99
Organism	Xanthomonas citri pv. citri strain DAR73886
Function	power the assembly of type IV pilus (predicted from homology) DNA binding and uptake

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type	MGE coordinates	Gene coordinates	Relative position	Distance (bp)
Genomic island	1227518..1249155	1227170..1227289	flank	229

Gene organization within MGE regions

Location: 1227170..1249155

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
H8Z71_RS05240 (H8Z71_05240)	pilB	1227170..1227289 (+)	120	WP_005915819.1	hypothetical protein	Machinery gene
H8Z71_RS05245 (H8Z71_05245)	-	1227421..1227588 (+)	168	WP_015463523.1	hypothetical protein	-
H8Z71_RS05250 (H8Z71_05250)	pilR	1227811..1229205 (-)	1395	WP_005930970.1	sigma-54 dependent transcriptional regulator	Regulator
H8Z71_RS05255 (H8Z71_05255)	-	1229530..1231143 (-)	1614	WP_003488599.1	HAMP domain-containing sensor histidine kinase	-
H8Z71_RS05260 (H8Z71_05260)	sucC	1231375..1232544 (+)	1170	WP_005915812.1	ADP-forming succinate--CoA ligase subunit beta	-
H8Z71_RS05265 (H8Z71_05265)	sucD	1232569..1233444 (+)	876	WP_005921370.1	succinate--CoA ligase subunit alpha	-
H8Z71_RS23320	-	1233531..1234046 (+)	516	WP_011052123.1	hypothetical protein	-
H8Z71_RS05275 (H8Z71_05275)	-	1234001..1235116 (-)	1116	WP_011052122.1	IS1595 family transposase	-
H8Z71_RS05280 (H8Z71_05280)	-	1235344..1235628 (-)	285	WP_016849322.1	hypothetical protein	-
H8Z71_RS05285 (H8Z71_05285)	-	1235733..1236539 (+)	807	WP_015463520.1	hypothetical protein	-
H8Z71_RS05290 (H8Z71_05290)	xopAI	1236959..1237849 (-)	891	WP_076605129.1	type III secretion system effector XopAI	-
H8Z71_RS05295 (H8Z71_05295)	-	1237983..1239085 (-)	1103	Protein_1041	DNA-binding protein	-
H8Z71_RS05300 (H8Z71_05300)	xopE	1239416..1240492 (-)	1077	WP_041471283.1	XopE/AvrPphe family type III secretion system effector	-
H8Z71_RS05305 (H8Z71_05305)	-	1240626..1241709 (-)	1084	Protein_1043	DNA-binding protein	-
H8Z71_RS05310 (H8Z71_05310)	-	1241902..1243175 (+)	1274	Protein_1044	site-specific integrase	-
H8Z71_RS05315 (H8Z71_05315)	-	1243184..1246174 (+)	2991	WP_015472512.1	Tn3 family transposase	-
H8Z71_RS05320 (H8Z71_05320)	-	1246307..1247584 (+)	1278	WP_005919631.1	lytic murein transglycosylase	-
H8Z71_RS05325 (H8Z71_05325)	avrXacE2	1247669..1248739 (+)	1071	WP_011052114.1	type III secretion system effector avirulence protein AvrXacE2	-

Sequence

Protein

Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113

                                >NTDB_id=476264 H8Z71_RS05240 WP_005915819.1 1227170..1227289(+) (pilB) [Xanthomonas citri pv. citri strain DAR73886]

MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD

Nucleotide

Download Length: 120 bp

                                >NTDB_id=476264 H8Z71_RS05240 WP_005915819.1 1227170..1227289(+) (pilB) [Xanthomonas citri pv. citri strain DAR73886]

ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT

GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA

Domains

No domain identified.

Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.

3D structure

Source	ID	Structure
AlphaFold DB	A0A7S6YV99

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.

Visualization of predicted probability:

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	H_a-value
pilB	Acinetobacter baylyi ADP1	51.282	100	0.513
pilB	Acinetobacter baumannii D1279779	48.718	100	0.487
pilB	Vibrio cholerae strain A1552	45.714	89.744	0.41
pilB	Legionella pneumophila strain ERS1305867	38.462	100	0.385

Detailed information NTG0476264