Detailed information
Bioinformatically predicted
Overview
| Name | comYE | Type | Machinery gene |
| Locus tag | H1R75_RS00965 | Genome accession | NZ_CP059471 |
| Coordinates | 142052..142345 (+) | Length | 97 a.a. |
| NCBI ID | WP_182001488.1 | Uniprot ID | - |
| Organism | Streptococcus equinus strain MDC1 | ||
| Function | dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Prophage | 103364..151640 | 142052..142345 | within | 0 |
Gene organization within MGE regions
Location: 103364..151640
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| H1R75_RS00680 (H1R75_00680) | - | 103364..104800 (-) | 1437 | WP_182001825.1 | recombinase family protein | - |
| H1R75_RS00685 (H1R75_00685) | - | 104939..105679 (-) | 741 | WP_182001455.1 | hypothetical protein | - |
| H1R75_RS00690 (H1R75_00690) | - | 105730..106464 (-) | 735 | WP_182001456.1 | XRE family transcriptional regulator | - |
| H1R75_RS00695 (H1R75_00695) | - | 106657..106863 (+) | 207 | WP_039697363.1 | helix-turn-helix transcriptional regulator | - |
| H1R75_RS00700 (H1R75_00700) | - | 107118..107261 (+) | 144 | WP_180367884.1 | BOW99_gp33 family protein | - |
| H1R75_RS00705 (H1R75_00705) | - | 107361..107612 (+) | 252 | WP_118101029.1 | transcriptional regulator | - |
| H1R75_RS00710 (H1R75_00710) | - | 107736..108116 (+) | 381 | WP_182001457.1 | DnaD domain-containing protein | - |
| H1R75_RS00715 (H1R75_00715) | - | 108126..108383 (+) | 258 | WP_182001458.1 | hypothetical protein | - |
| H1R75_RS00720 (H1R75_00720) | - | 108386..108610 (+) | 225 | WP_043895081.1 | hypothetical protein | - |
| H1R75_RS00725 (H1R75_00725) | - | 108607..108756 (+) | 150 | WP_182001459.1 | hypothetical protein | - |
| H1R75_RS00730 (H1R75_00730) | - | 108744..109418 (+) | 675 | WP_182001460.1 | ERF family protein | - |
| H1R75_RS00735 (H1R75_00735) | - | 109430..110443 (+) | 1014 | WP_182001461.1 | DUF1351 domain-containing protein | - |
| H1R75_RS00740 (H1R75_00740) | - | 110440..110607 (+) | 168 | WP_182001462.1 | hypothetical protein | - |
| H1R75_RS00745 (H1R75_00745) | - | 110746..110952 (+) | 207 | WP_182001463.1 | hypothetical protein | - |
| H1R75_RS00750 (H1R75_00750) | - | 110962..111192 (+) | 231 | WP_182001464.1 | hypothetical protein | - |
| H1R75_RS00755 (H1R75_00755) | - | 111198..111977 (+) | 780 | WP_039697398.1 | DNA methyltransferase | - |
| H1R75_RS00760 (H1R75_00760) | - | 111974..112189 (+) | 216 | WP_039697372.1 | hypothetical protein | - |
| H1R75_RS00765 (H1R75_00765) | - | 112186..112923 (+) | 738 | WP_182001465.1 | ORF6C domain-containing protein | - |
| H1R75_RS00770 (H1R75_00770) | - | 112933..113151 (+) | 219 | WP_148525567.1 | hypothetical protein | - |
| H1R75_RS00775 (H1R75_00775) | - | 113138..113386 (+) | 249 | WP_148525565.1 | hypothetical protein | - |
| H1R75_RS09890 | - | 113647..113778 (+) | 132 | WP_268926161.1 | hypothetical protein | - |
| H1R75_RS00780 (H1R75_00780) | - | 113780..113992 (+) | 213 | WP_182001466.1 | crAss001_48 related protein | - |
| H1R75_RS00785 (H1R75_00785) | - | 114029..114583 (+) | 555 | WP_328804807.1 | hypothetical protein | - |
| H1R75_RS00790 (H1R75_00790) | - | 114576..114791 (+) | 216 | WP_182001467.1 | hypothetical protein | - |
| H1R75_RS00795 (H1R75_00795) | - | 114793..115029 (+) | 237 | WP_020917136.1 | hypothetical protein | - |
| H1R75_RS00800 (H1R75_00800) | - | 115038..115430 (+) | 393 | WP_148525557.1 | hypothetical protein | - |
| H1R75_RS00805 (H1R75_00805) | - | 115505..115987 (+) | 483 | WP_143888178.1 | terminase small subunit | - |
| H1R75_RS00810 (H1R75_00810) | - | 115977..117287 (+) | 1311 | WP_020917133.1 | PBSX family phage terminase large subunit | - |
| H1R75_RS00815 (H1R75_00815) | - | 117297..118847 (+) | 1551 | WP_182001468.1 | phage portal protein | - |
| H1R75_RS00820 (H1R75_00820) | - | 118840..119979 (+) | 1140 | Protein_109 | phage minor capsid protein | - |
| H1R75_RS00825 (H1R75_00825) | - | 120339..120569 (+) | 231 | WP_182001470.1 | hypothetical protein | - |
| H1R75_RS00830 (H1R75_00830) | - | 120730..121287 (+) | 558 | WP_143888182.1 | phage scaffolding protein | - |
| H1R75_RS00835 (H1R75_00835) | - | 121301..122173 (+) | 873 | WP_182001471.1 | hypothetical protein | - |
| H1R75_RS00840 (H1R75_00840) | - | 122184..122363 (+) | 180 | WP_020917127.1 | hypothetical protein | - |
| H1R75_RS00845 (H1R75_00845) | - | 122363..122623 (+) | 261 | WP_148525546.1 | hypothetical protein | - |
| H1R75_RS00850 (H1R75_00850) | - | 122654..123046 (+) | 393 | WP_182001472.1 | hypothetical protein | - |
| H1R75_RS00855 (H1R75_00855) | - | 123036..123362 (+) | 327 | WP_043895078.1 | putative minor capsid protein | - |
| H1R75_RS00860 (H1R75_00860) | - | 123362..123709 (+) | 348 | WP_182001473.1 | minor capsid protein | - |
| H1R75_RS00865 (H1R75_00865) | - | 123709..124107 (+) | 399 | WP_182001474.1 | minor capsid protein | - |
| H1R75_RS00870 (H1R75_00870) | - | 124118..124576 (+) | 459 | WP_182001475.1 | phage tail tube protein | - |
| H1R75_RS00875 (H1R75_00875) | - | 124590..124967 (+) | 378 | WP_182001476.1 | hypothetical protein | - |
| H1R75_RS00880 (H1R75_00880) | - | 124967..125548 (+) | 582 | WP_182001477.1 | bacteriophage Gp15 family protein | - |
| H1R75_RS00885 (H1R75_00885) | - | 125563..129513 (+) | 3951 | WP_182001478.1 | tape measure protein | - |
| H1R75_RS00890 (H1R75_00890) | - | 129510..130997 (+) | 1488 | WP_182001479.1 | distal tail protein Dit | - |
| H1R75_RS00895 (H1R75_00895) | - | 130998..132176 (+) | 1179 | Protein_124 | phage tail spike protein | - |
| H1R75_RS00900 (H1R75_00900) | - | 132774..133892 (+) | 1119 | WP_118101006.1 | hypothetical protein | - |
| H1R75_RS00905 (H1R75_00905) | - | 133908..134153 (+) | 246 | WP_182001481.1 | hypothetical protein | - |
| H1R75_RS00910 (H1R75_00910) | - | 134098..136212 (+) | 2115 | WP_182001482.1 | hypothetical protein | - |
| H1R75_RS00915 (H1R75_00915) | - | 136227..138305 (+) | 2079 | WP_182001483.1 | DUF859 family phage minor structural protein | - |
| H1R75_RS00920 (H1R75_00920) | - | 138318..138659 (+) | 342 | WP_118101002.1 | DUF1366 domain-containing protein | - |
| H1R75_RS00925 (H1R75_00925) | - | 138685..138843 (+) | 159 | WP_182001484.1 | hypothetical protein | - |
| H1R75_RS00930 (H1R75_00930) | - | 138865..139197 (+) | 333 | WP_020917109.1 | hypothetical protein | - |
| H1R75_RS00935 (H1R75_00935) | - | 139210..139536 (+) | 327 | WP_111698489.1 | phage holin | - |
| H1R75_RS00940 (H1R75_00940) | - | 139533..140378 (+) | 846 | WP_182001485.1 | lytic exoenzyme target recognition domain-containing protein | - |
| H1R75_RS00945 (H1R75_00945) | - | 140889..141035 (+) | 147 | WP_180367887.1 | hypothetical protein | - |
| H1R75_RS00950 (H1R75_00950) | - | 141185..141385 (+) | 201 | WP_148525789.1 | XRE family transcriptional regulator | - |
| H1R75_RS00955 (H1R75_00955) | comYC | 141450..141683 (+) | 234 | WP_182001486.1 | competence type IV pilus major pilin ComGC | Machinery gene |
| H1R75_RS00960 (H1R75_00960) | comGD | 141667..142098 (+) | 432 | WP_182001487.1 | competence type IV pilus minor pilin ComGD | - |
| H1R75_RS00965 (H1R75_00965) | comYE | 142052..142345 (+) | 294 | WP_182001488.1 | competence type IV pilus minor pilin ComGE | Machinery gene |
| H1R75_RS00970 (H1R75_00970) | comYF | 142329..142766 (+) | 438 | WP_003067903.1 | competence type IV pilus minor pilin ComGF | Machinery gene |
| H1R75_RS00975 (H1R75_00975) | comGG | 142795..143088 (+) | 294 | WP_234704406.1 | competence type IV pilus minor pilin ComGG | - |
| H1R75_RS00980 (H1R75_00980) | comYH | 143142..144098 (+) | 957 | WP_182001489.1 | class I SAM-dependent methyltransferase | Machinery gene |
| H1R75_RS00985 (H1R75_00985) | - | 144152..145351 (+) | 1200 | WP_182001490.1 | acetate kinase | - |
| H1R75_RS00990 (H1R75_00990) | - | 145509..145706 (+) | 198 | WP_027968026.1 | helix-turn-helix transcriptional regulator | - |
| H1R75_RS00995 (H1R75_00995) | - | 145762..146214 (+) | 453 | WP_074483978.1 | ABC transporter permease | - |
| H1R75_RS01000 (H1R75_01000) | - | 146226..146861 (+) | 636 | WP_182001491.1 | CPBP family intramembrane glutamic endopeptidase | - |
| H1R75_RS01005 (H1R75_01005) | proC | 146913..147683 (-) | 771 | WP_182001492.1 | pyrroline-5-carboxylate reductase | - |
| H1R75_RS01010 (H1R75_01010) | pepA | 147745..148812 (-) | 1068 | WP_074483975.1 | glutamyl aminopeptidase | - |
| H1R75_RS01015 (H1R75_01015) | - | 148929..149222 (+) | 294 | WP_182001493.1 | DUF4651 domain-containing protein | - |
| H1R75_RS01020 (H1R75_01020) | - | 149215..149532 (+) | 318 | WP_021141448.1 | thioredoxin family protein | - |
| H1R75_RS01025 (H1R75_01025) | ytpR | 149541..150167 (+) | 627 | WP_182001494.1 | YtpR family tRNA-binding protein | - |
| H1R75_RS01030 (H1R75_01030) | ssbA | 150265..150660 (+) | 396 | WP_021141449.1 | single-stranded DNA-binding protein | Machinery gene |
| H1R75_RS01035 (H1R75_01035) | - | 150840..151640 (+) | 801 | WP_039697668.1 | Cof-type HAD-IIB family hydrolase | - |
Sequence
Protein
Download Length: 97 a.a. Molecular weight: 10959.82 Da Isoelectric Point: 6.8788
>NTDB_id=469802 H1R75_RS00965 WP_182001488.1 142052..142345(+) (comYE) [Streptococcus equinus strain MDC1]
MVIIKRQKLKAYILLESLAALALLATITILVLGEMDKSRHQMQDSLHQQEVLNVATMAAQTGQDDLVMNGVEVHITRRDG
ELYVYDGQKEVMHVKKN
MVIIKRQKLKAYILLESLAALALLATITILVLGEMDKSRHQMQDSLHQQEVLNVATMAAQTGQDDLVMNGVEVHITRRDG
ELYVYDGQKEVMHVKKN
Nucleotide
Download Length: 294 bp
>NTDB_id=469802 H1R75_RS00965 WP_182001488.1 142052..142345(+) (comYE) [Streptococcus equinus strain MDC1]
GTGGTAATTATAAAAAGACAGAAACTAAAAGCTTACATACTCCTTGAAAGTTTGGCTGCTTTAGCTTTGCTAGCTACCAT
TACAATTCTTGTTTTGGGAGAAATGGATAAAAGTCGCCACCAGATGCAAGACAGCTTACATCAGCAAGAGGTTCTCAATG
TTGCTACTATGGCTGCTCAGACAGGGCAAGATGACTTGGTGATGAATGGTGTTGAGGTTCATATTACTAGACGAGACGGA
GAACTTTATGTCTACGATGGGCAAAAAGAGGTGATGCATGTTAAGAAGAACTAG
GTGGTAATTATAAAAAGACAGAAACTAAAAGCTTACATACTCCTTGAAAGTTTGGCTGCTTTAGCTTTGCTAGCTACCAT
TACAATTCTTGTTTTGGGAGAAATGGATAAAAGTCGCCACCAGATGCAAGACAGCTTACATCAGCAAGAGGTTCTCAATG
TTGCTACTATGGCTGCTCAGACAGGGCAAGATGACTTGGTGATGAATGGTGTTGAGGTTCATATTACTAGACGAGACGGA
GAACTTTATGTCTACGATGGGCAAAAAGAGGTGATGCATGTTAAGAAGAACTAG
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comYE | Streptococcus mutans UA140 |
48.958 |
98.969 |
0.485 |
| comYE | Streptococcus mutans UA159 |
48.958 |
98.969 |
0.485 |
| comGE/cglE | Streptococcus pneumoniae Rx1 |
40.86 |
95.876 |
0.392 |
| comGE/cglE | Streptococcus pneumoniae D39 |
40.86 |
95.876 |
0.392 |
| comGE/cglE | Streptococcus pneumoniae R6 |
40.86 |
95.876 |
0.392 |
| comGE/cglE | Streptococcus pneumoniae TIGR4 |
40.86 |
95.876 |
0.392 |
| comGE/cglE | Streptococcus mitis SK321 |
39.785 |
95.876 |
0.381 |
| comGE/cglE | Streptococcus mitis NCTC 12261 |
39.785 |
95.876 |
0.381 |