Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   I33_RS02085 Genome accession   NC_017195
Coordinates   421312..421434 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis str. RO-NN-1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 416312..426434
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  I33_RS02070 (I33_0428) yclJ 417926..418609 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  I33_RS02075 (I33_0429) yclK 418596..420017 (+) 1422 WP_080009753.1 two-component system sensor histidine kinase YclK -
  I33_RS02080 (I33_0430) rapC 420180..421328 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  I33_RS02085 (I33_0431) phrC 421312..421434 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  I33_RS20000 (I33_0432) yczM 421534..421623 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  I33_RS20005 (I33_0433) yczN 421705..421818 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  I33_RS02100 (I33_0434) thrD 421971..423335 (-) 1365 WP_014475802.1 aspartate kinase -
  I33_RS02105 (I33_0436) ceuB 423720..424670 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  I33_RS02110 (I33_0437) yclO 424663..425610 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  I33_RS02115 (I33_0438) yclP 425604..426362 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=45383 I33_RS02085 WP_003224994.1 421312..421434(+) (phrC) [Bacillus subtilis subsp. subtilis str. RO-NN-1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=45383 I33_RS02085 WP_003224994.1 421312..421434(+) (phrC) [Bacillus subtilis subsp. subtilis str. RO-NN-1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment