Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   HR084_RS02200 Genome accession   NZ_CP054177
Coordinates   431863..431985 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain JCL16     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 426863..436985
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  HR084_RS02185 (HR084_02185) yclJ 428477..429160 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  HR084_RS02190 (HR084_02190) yclK 429147..430568 (+) 1422 WP_173613904.1 two-component system sensor histidine kinase YclK -
  HR084_RS02195 (HR084_02195) rapC 430731..431879 (+) 1149 WP_024571686.1 response regulator aspartate phosphatase RapC Regulator
  HR084_RS02200 (HR084_02200) phrC 431863..431985 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  HR084_RS02205 (HR084_02205) yczM 432085..432174 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  HR084_RS02210 (HR084_02210) yczN 432256..432369 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  HR084_RS02215 (HR084_02215) thrD 432523..433887 (-) 1365 WP_153255669.1 aspartate kinase -
  HR084_RS02220 (HR084_02220) ceuB 434272..435222 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  HR084_RS02225 (HR084_02225) yclO 435215..436162 (+) 948 WP_173613905.1 petrobactin ABC transporter permease YclO -
  HR084_RS02230 (HR084_02230) yclP 436156..436914 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=451299 HR084_RS02200 WP_003224994.1 431863..431985(+) (phrC) [Bacillus subtilis strain JCL16]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=451299 HR084_RS02200 WP_003224994.1 431863..431985(+) (phrC) [Bacillus subtilis strain JCL16]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1