Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   HCN55_RS02120 Genome accession   NZ_CP050532
Coordinates   423243..423365 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis str. SMY     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 418243..428365
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  HCN55_RS02105 (HCN55_02105) yclJ 419857..420540 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  HCN55_RS02110 (HCN55_02110) yclK 420527..421948 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  HCN55_RS02115 (HCN55_02115) rapC 422111..423259 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  HCN55_RS02120 (HCN55_02120) phrC 423243..423365 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  HCN55_RS02125 (HCN55_02125) yczM 423465..423554 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  HCN55_RS02130 (HCN55_02130) yczN 423636..423749 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  HCN55_RS02135 (HCN55_02135) thrD 423903..425267 (-) 1365 WP_009966541.1 aspartate kinase -
  HCN55_RS02140 (HCN55_02140) ceuB 425652..426602 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  HCN55_RS02145 (HCN55_02145) yclO 426595..427542 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  HCN55_RS02150 (HCN55_02150) yclP 427536..428294 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=433709 HCN55_RS02120 WP_003224994.1 423243..423365(+) (phrC) [Bacillus subtilis subsp. subtilis str. SMY]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=433709 HCN55_RS02120 WP_003224994.1 423243..423365(+) (phrC) [Bacillus subtilis subsp. subtilis str. SMY]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1